Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

cpxR from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1436
Gene Name cpxR from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3078361
NCBI Protein GI 52841668
Locus Tag lpg1438
Protein Accession YP_095467.1
Other Database IDs UniProtKB-ID: Q5ZVK2_LEGPH
UniRef100: UniRef100_Q5WW57
UniRef90: UniRef90_D3HTB6
UniRef50: UniRef50_A9FFH2
UniParc: UPI00001B67A3
EMBL: AE017354
EMBL-CDS: AAU27520.1
RefSeq_NT: NC_002942.5
GenomeReviews: AE017354_GR
KEGG: lpn:lpg1438
eggNOG: COG0745
HOGENOM: HBG753323
OMA: THSQANE
ProtClustDB: CLSK832796
BioCyc: LPNE272624:LPG1438-MONOMER
Taxonomy ID 272624
Gene Starting Position 1587284
Gene Ending Position 1587964
Gene Strand (Orientation) -
Protein Name transcriptional regulatory protein CpxR
DNA Sequence
>gi|52840256:1587284-1587964 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
ACTACGCATTAAACATGTACCCAAACCCGCGGACAGTTTTGACTAAAGGTTCTCCCTGAGGATTATCGCC
TAATTTATTTCGCAAATTGCTGATGTGAACATCGATACTGCGGTCATAAGCAGTGTATTTTCTTCCCAGA
GCATATTCGGTGAGTTCCTCTTTGGAAAATGCTTGCCCTGGTGATTTGATTAACATCTCCAAAATATTAA
ATTCCGCATTGGTTAATTCAAGGAATTTTCCTCCCATAGTCACGTGGCGTTTGGAGCAATCCACAATGAT
ATTATGTTGTTCAATAATAGGTTTGGGAGTTGGGATTTTTTGAGTGCGTCTTAAAATAGCACGCAGACGT
GCAACTAACTCTCGTGGATTACAAGGTTTAGGTAAGTAATCATCTGCACCAATTTCTAACCCAACAATGC
GATCGATATCATCACCACGAGCAGTTAACATCAATACAGGTGTTTCCAAATGCTCTCTTATTGCCTTTAA
TACTTCAAAACCATTAAGCTTAGGCAGCATGACGTCGAGTATAATGGCATCAAATACCTGATTTAAAGCT
CTTTTAACGCCATTTTCTCCATCATGCACACATACTACATTAAAGCCTTCTGGTTCCAAATATTGGGTTA
ATAAATCTGTTAGTTCTGTGTCATCATCAATAATGAGAATAGAGCTGCTCA
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: cpxR mutant is attenuated in mouse macrophages (Vincent et al., 2006).
COG COG0745TK, under T: Signal transduction mechanisms; K: Transcription
References
Vincent et al., 2006: Vincent CD, Buscher BA, Friedman JR, Williams LA, Bardill P, Vogel JP. Identification of non-dot/icm suppressors of the Legionella pneumophila DeltadotL lethality phenotype. Journal of bacteriology. 2006; 188(23); 8231-8243. [PubMed: 16997951].