Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

mip from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1437
Gene Name mip from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3078495
NCBI Protein GI 52841028
Locus Tag lpg0791
Protein Accession YP_094827.1
Other Database IDs UniProtKB-ID: MIP_LEGPH
UniRef100: UniRef100_Q5ZXE0
UniRef90: UniRef90_Q5ZXE0
UniRef50: UniRef50_Q5ZXE0
UniParc: UPI0000001582
EMBL: S42595
EMBL: AE017354
EMBL-CDS: AAB22717.1
EMBL-CDS: AAU26880.1
RefSeq_NT: NC_002942.5
PDB: 1FD9
PDB: 2UZ5
PDB: 2VCD
GenomeReviews: AE017354_GR
KEGG: lpn:lpg0791
HOGENOM: HBG731200
ProtClustDB: CLSK914199
BioCyc: LPNE272624:LPG0791-MONOMER
Taxonomy ID 272624
Gene Starting Position 866843
Gene Ending Position 867550
Gene Strand (Orientation) +
Protein Name macrophage infectivity potentiator (Mip)
DNA Sequence
>gi|52840256:866843-867550 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
ATTGTTTATGAAGATGAAATTGGTGACTGCAGCTGTTATGGGGCTTGCAATGTCAACAGCAATGGCTGCA
ACCGATGCCACATCATTAGCTACAGACAAGGATAAGTTGTCTTATAGCATTGGTGCCGATTTGGGGAAGA
ATTTTAAAAATCAAGGCATAGATGTTAATCCGGAAGCAATGGCTAAAGGCATGCAAGACGCTATGAGTGG
CGCTCAATTGGCTTTAACCGAACAGCAAATGAAAGACGTTCTTAACAAGTTTCAGAAAGATTTGATGGCT
AAGCGTACTGCTGAATTCAATAAGAAAGCGGATGAAAATAAAGTAAAAGGGGAAGCCTTTTTAACTGAAA
ACAAAAACAAGCCAGGCGTTGTTGTATTGCCAAGTGGTTTGCAATACAAAGTAATCAATTCTGGAAATGG
TGTTAAACCCGGAAAATCGGATACAGTCACTGTCGAATATACTGGTCGTCTGATTGATGGTACCGTTTTT
GACAGTACCGAAAAAACTGGTAAGCCAGCAACGTTCCAGGTTTCACAAGTTATCCCTGGATGGACAGAAG
CTTTGCAATTGATGCCAGCTGGATCAACTTGGGAAATTTATGTTCCCTCAGGTCTTGCATATGGCCCACG
TAGCGTTGGCGGACCTATTGGCCCAAATGAAACTTTAATATTTAAAATTCACTTAATTTCAGTGAAAAAA
TCATCTTA
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: mip mutants are approximately 50- to 100-fold less infective for A. castellanii and for human mononuclear phagocytes in vitro compared with their isogenic Mip-positive parental strains (Wintermeyer et al., 1995).
COG COG0545O, under O: Posttranslational modification, protein turnover, chaperones
References
Wintermeyer et al., 1995: Wintermeyer E, Ludwig B, Steinert M, Schmidt B, Fischer G, Hacker J. Influence of site specifically altered Mip proteins on intracellular survival of Legionella pneumophila in eukaryotic cells. Infection and immunity. 1995; 63(12); 4576-4583. [PubMed: 7591108].