Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

icmX from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1440
Gene Name icmX from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3079093
NCBI Protein GI 52842895
Locus Tag lpg2689
Protein Accession YP_096694.1
Other Database IDs UniProtKB-ID: Q5ZS30_LEGPH
UniRef100: UniRef100_Q5ZS30
UniRef90: UniRef90_Q5ZS30
UniRef50: UniRef50_Q5X1K0
UniParc: UPI00000B4794
EMBL: AE017354
EMBL-CDS: AAU28747.1
RefSeq_NT: NC_002942.5
TCDB: 3.A.7.9.1
GenomeReviews: AE017354_GR
KEGG: lpn:lpg2689
NMPDR: fig|272624.3.peg.2639
HOGENOM: HBG520266
OMA: QINDASP
ProtClustDB: CLSK833558
BioCyc: LPNE272624:LPG2689-MONOMER
Taxonomy ID 272624
Gene Starting Position 3038598
Gene Ending Position 3039998
Gene Strand (Orientation) +
Protein Name IcmX (IcmY)
DNA Sequence
>gi|52840256:3038598-3039998 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
AATGAAAGTATTACCTAAACTGGCCTTGGCCAATCTGGTTTGTTTTACCACTTTATCTGTTTTTGCTCAA
CCTGCTGACCCATCTGGACAACAGACAAGCACCAACACCTCCAATCTGGTGACCTACCTGACGAACCTGG
GAAAATATTTAGGCTATGATATCACTCAATCCAGCAAAGCCCCTAACCCGCCTTATTCGCAATTATTCAA
TTCCAATGTAGTTCAACTCGTTCAAAATTACGCCTATAATACCTTTTTGGGCGCTATTCCTGTCGATGCC
ATGTCGCAGAGCTTAATGAATTTTGTTACCGATAAGGTACAAGGAAATTCATTAATTAATAATTTGGCAA
ATACTACTTTTAAATATCAAAATTTCAGCGCCCCATCCTCCGGCGCAGATGGGAAAATTACAGCGAACGG
CTTAATAGATCAATCAACAGCTAGTGCCCAAACACCCACAACACCTGGCATTTTTTCAGCGCCTCAAATC
ACAACCTCCGGGACATACTTAAATGACCCAGTCAGTCAGGCAGTATTCAATATTCTGGGCACCCCGGATT
ACAGTTTTTGTATGGACAATGAACAAAAGAACTGGTTACCCAATTGTAACCTCATGTATCAAAATCTGGT
CATGCAAAATGTAATTGGCACTTTGCCGCCAGCACAAACCTCTGGTTCAACGCCTGCTTTTTATTCCTAC
AAATACAATCAACCGCTTATAAGTCAACTGAACAGTAACTCTTTGATTGCCCCCTTACTGATGGATACCT
CTGCGTCACAATCTGGGCAAGATTCTGGATTAACGGCAAAAAGCCAAGCCCAGCAAGCGCTTAATTTTAT
CAGATACGCAAGCGCTCAAGTCACCCCTCCTTCCTTACCCAAGTTGAGTGCATACAGTGAGTTATGGAAT
CAAGCCACTGCAAAACCCAATTCTGCAGGCTATAATGAAGTCCAACAAAAACAAGCAGCCGCAACATTAA
GCAGTTATTTTAATAATTTGCGTGTTTATGCAGCGCAAACTTCTGTTGGCGTGAGCAACCTCTACTATAT
TTTATCCAAAAGGTTACCTCAAAATATGAGTGCAGACCAAAGTAACGCTAATATCACAAGCCAAGCGCTG
AATGAATTTAACATGGCTACTCGACGATTATTTGATCCTACCGCCTCCAACACTCCTGGACAACCAAACC
AACAATGGATTAAACAAATTAATGACGCATCCCCTGCTACAGTTCAAAAAGAAATAGCGATATTGCTGGC
TGAAATTAATTATCAAATGTATTTGGACAGACAAATACAAGAACGAATATTATTAACCAATAGCATTATG
CTATTGCAAAATTTAAAAGCCGCTCAACCCACTGCTGATTTTTCAAGTCAAGGCTCTCCTTCTGAGCAAT
A
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: icmX mutant is attenuated in guinea pigs (Edelstein et al., 1999).
References
Edelstein et al., 1999: Edelstein PH, Edelstein MA, Higa F, Falkow S. Discovery of virulence genes of Legionella pneumophila by using signature tagged mutagenesis in a guinea pig pneumonia model. Proceedings of the National Academy of Sciences of the United States of America. 1999; 96(14); 8190-8195. [PubMed: 10393970].