Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

dotB from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1442
Gene Name dotB from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3079449
NCBI Protein GI 52842882
Locus Tag lpg2676
Protein Accession YP_096681.1
Other Database IDs UniProtKB-ID: Q5ZS43_LEGPH
UniRef100: UniRef100_Q5ZS43
UniRef90: UniRef90_Q5ZS43
UniRef50: UniRef50_Q5ZS43
UniParc: UPI0000442A30
EMBL: AE017354
EMBL-CDS: AAU28734.1
RefSeq_NT: NC_002942.5
TCDB: 3.A.7.9.1
GenomeReviews: AE017354_GR
KEGG: lpn:lpg2676
eggNOG: COG2805
HOGENOM: HBG757455
OMA: IISERVY
ProtClustDB: CLSK914927
BioCyc: LPNE272624:LPG2676-MONOMER
Taxonomy ID 272624
Gene Starting Position 3022672
Gene Ending Position 3023835
Gene Strand (Orientation) +
Protein Name DotB
DNA Sequence
>gi|52840256:3022672-3023835 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
CCTGGCAACCTATTATAGCACCAGTAAGTTAATGTCTATGGATAATATTAATTTAATGCCCGATGAGCCA
ACTCGTTTCACTCCAGTATTCATGGACAGAATGCTGGAGCATGCAGAAAGCCTGAATGCTTCAGATATAA
CAATCCAAACTGGCGAACCCATTTTTGCAGAGGTTTATGGAAGACTCCTTAAAATTACAAATCGACGTCT
TTCCAATACAGAATTGGGCGACCTTATTAATTCCATTTATGGCCCGAATGCCACGACACAATTACTTTCC
GGTAAAGATATAGATACTCATTATGAGTTTCGACCCAACCGTGGTGTACGCTATCGATATAGGGTTAACG
CGACTGCCTGCCTGGTTGAAGGTCATGATGCCATTCAAATCACATTAAGAACTATTCCAACCACGCCACC
CAAACTCAGTACCATGAACCTCCCTGATAACATTATTGAAGCGATTGCTCCACAGGAAGGAATCGTGTTT
ATTACAGGCGCTACCGGTTCGGGCAAATCGACATTGTTAGCTTCCATTATTCGAGAACTTATTGAAACAT
CAGACTCAAACCGTAAAGTATTAACTTACGAATCCCCGATAGAATTCGTCTATGATGAAATTGAAACAAT
TTCCGCTGTAGTAAGCCAATCAGAGATTCCAAGACACTTACCCAACTTTGCTGATGGAGTAAGAAACGCA
TTAAGACGAAAGCCAAGATTAATTATGGTGGGTGAATGTCGTGATGCAGAAACCATCAGTGCCGCTCTTG
AAGCCGCTTTAACAGGGCACCCTGTCTACACAACCCTGCATACTTCTGGTGTTGCAGAAACAATGCGACG
TCTGGTCACATCTTTTAGCGGGGAAGAGCGTTTGGGAAGAACCATCGATATTCTTGAAACAATTAGGCTT
TGCATTTGGCAAAAACTGGTCCCAACCGTTGATGAAAGACGTGTAGCCCTAAGGGAGTATCTGGTATTCG
ATGAAGAAGTGAGAGATATTCTATTGGAGGGAGACCCTAACGAAGTGACTTCAGCCACTCGTAAGTTAGT
GAGGCAAAAAGGGCAGTTAATGACTTGGGACGCAAAAATGAAATTTGAACAGGGGATTATCAGTGAGCGA
GTTTATAAATTAATCATTGCTGGGGCCAAAGAATATCAACAATA
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: dotB mutant is attenuated in guinea pigs (Edelstein et al., 1999).
COG COG2805NU, under N: Cell motility; U: Intracellular trafficking, secretion, and vesicular transport
References
Edelstein et al., 1999: Edelstein PH, Edelstein MA, Higa F, Falkow S. Discovery of virulence genes of Legionella pneumophila by using signature tagged mutagenesis in a guinea pig pneumonia model. Proceedings of the National Academy of Sciences of the United States of America. 1999; 96(14); 8190-8195. [PubMed: 10393970].