Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

dotA from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1443
Gene Name dotA from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3079451
NCBI Protein GI 52842892
Locus Tag lpg2686
Protein Accession YP_096691.1
Other Database IDs UniProtKB-ID: Q5ZS33_LEGPH
UniRef100: UniRef100_Q5ZS33
UniRef90: UniRef90_Q5ZS33
UniRef50: UniRef50_Q5ZS33
UniParc: UPI0000442A39
EMBL: AE017354
EMBL-CDS: AAU28744.1
RefSeq_NT: NC_002942.5
GenomeReviews: AE017354_GR
KEGG: lpn:lpg2686
NMPDR: fig|272624.3.peg.2636
eggNOG: NOG41268
HOGENOM: HBG520268
OMA: LQASERI
ProtClustDB: CLSK833557
BioCyc: LPNE272624:LPG2686-MONOMER
Taxonomy ID 272624
Gene Starting Position 3034432
Gene Ending Position 3037578
Gene Strand (Orientation) -
Protein Name DotA
DNA Sequence
>gi|52840256:3034432-3037578 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
GTTATTCGGGAGGTGGGGTACTGGTTGGGGTACCACTATCAGAACCGCCCAGTTGTTGACCTGTATCAGG
TTTCGAGCTTGGTCCAGTCTGGCTGCCTCCACTGTTCTTACCTTTCCCTGAAACATCACCCGCATTTTCC
GAAATCTTTTTAGCTTGAGGCCCCAATTTGCCAAGCATCTCTTGCCCTTTAGCCCCCAATTTGTCACCAA
TAGCTTTCTCAGCCCCATAAGTAGCTTCGCCTGCTTTCTCTACTCTACCTTTGGCTTCCTCACCCCATTG
CATTGTTTCTTGACCAAAAGATTCCGGACTACCACCTATCCATCTCAGCACTTTATCTGGCAGGTGAGCA
ATCAGTGTAAAGGCTTTTTGTACAATAATTAAATACATACTGGTATAAATTAAGATGGAGAAGAAGAAAG
CATACACTCCTGCCCAGCCTGTATACCCACCTTCTAATGCAGTTGATTGATAATCACCTGTCAACTTATC
CTTAAAATTATCCCATTGCGATGTATCCATCTTTGCTCCAGTCCAGTTCCCGGCGCTCTGGAAAAACCTC
TTCGCATCATTCGAACTGGTGCCTTTTTCCCATGTTTCTATTCCTTGATCCGATTGGATGTAGGAAATGG
CATGATCAAATCCGGCATTCAAAATCCACACGCCAACATAAGACAAGGCAATCGCTGCAATATATCCTAT
TATCATCAGAGAAGGTCTTAAAAAGACATTAACCAAAATCATAATGGCAAATTCACCTTTACCAAAAGCC
TCATTACCTTCTGGATGCGTAACACCCAAGGCGACAATAGGTGCAGCCACCATAGCCTCGATAACGGCTA
TCAGCCAGGCAAATGATCCAAAAGTGAAAATCATATAAGGTAAAACAGGTATATAATATGCTGTAACAAA
TCCTATGGATACCATGGTCCCTATCCATGCCATCAACAAAGGCATAGCCATCATAATCAAGGCAAAGATA
AAGATACCAAAAAGTGGTATTAGTGAACTGACCACTGCCATATTCAACAGCGTTAGCCACAAAGTACCAG
AAAAATTAATATACATCGTTCCCATATTAGCCAATGCGACAATGGGGTTTATTCCAGGCTGTGTCAGCGT
TTGCACTCCCACTATGAAAATATCTTTCATGCCTTGTAAAGGAATCATTAAAAAGGCCATGACGATGGAA
TTAATCATTTCTCCGAATATGGCTAAAAAGAAGTTGTACACATACCTGAAAACATAGTTATAAAATAAGT
CACCCATCATACGGCCAAGGCAAAACGAGAAGAACAAAATCTTCACCCTGCCGCAATCAAAATCCTGGTG
CTTCATATAATAAAGCGACGTATCTACTTTAAAATTAATCAGATTGGCAAAGGTCAACGGTTTTATTCCT
GGTTGACCTGGCAATTGAACCATCATGGAATTGTTGACAAATCCATAGACTGTTGAGGACAATGGCCCAC
TCACAGACTGTCGTTGAGGATTATCACTAAGATCAGGTTGCTTGACGCCATCCTGACCTAAAGCAGGTAC
GCCATCGATTAGTGACTGGATTTGAATCAGCTTATCACTCTTGTTTTGAAACCAGGTACACAATAATGAA
TAGGGATCCTGACACGTTTTTCCAAAGGGTTTGGTAAGCTGTGTGGGATCAAAACTACTCTTATCTAGGC
CTGTTCCCGTATCAAATTGGTCTGCAAACTCAGTTGCGCTTCCATTGAGTTTCACCAAATCAAAAAAGTA
AGAGCCAGCCATGATCCATCCTTTGGCATTGGCTTCTGCAATAAAATCACGGGATTTCTTATCAAATTCT
TTAGACGTAGCTTGTCTTATCAGATTGAGAGTTGGCATCATAATGCCATTATAATCATTAATTGCACCTA
AAAATTCGGTGCCATTAAACAATACTCCTGTAGTAGATCCGGTGGAACTGGGTACCGACCCCCATGTTTG
GCAAACTTGTTGATACTCAGTGCAAACCTCACCGGATGACTTATAAGGAACTCCAAACTGCTGTTTGGCA
ATAGCGGAAAAATCATTTTTTGAGTTTCCGGTAGACGTGGTTGTTGAAAACGCCGGATCATTATTAACCA
TGACCTGTGCCACAGTAGACAAAGTCACATACATTTGCTGTATGGCAATCGCGCGAGACAATCGGGCTGT
TTGCAATTGAGAAGAAGTTATATTTAAGCTGTTAGCGCCCATGGATGAATTGGATCCAGCCCCTCCTACT
GTCACAAGCCCTTTATTATCACTTTGATTCGTTGAGTTCAAAGCGGAAATATTATTCCATTTGACTGTGC
CGCAAATCCCGTTTAAGAAATAAAATGGTGAACTTTTATCGAAATTTGGCATGTCCAGTTCAAAAGAAGC
GGGCTGGTTTGCCGTTAGATCTTTAGGCGTATCATCATTTTGTTTCTTGACAAAATTTACCGTACTGATG
AAATCAGGAATCGCTGTGCGGCAAAAAGTATTCATTTCAGGAGTAGGATTACCCCCACAAGGTGGACTCT
TACTTTGACTCAAATAAAGATCTCTTTGTGCTTGTAATTGTTTTTGTAAACCCAACATGCAGATTTGGCC
ACCCAATATAGTTAACGCTCCCTTTGCAACACCGGAAGACGAAGATCCGGCTGCTTGCAAGCTCTTGGTT
GGATCGGCCTGAGCCTGTATTATCACGCCACCCCGGTTGAGATAACTCAAGGCGGCTTCCCATATTTTAT
CGGCTGCACCAACGCCTTGCACGATAACCCACATAAAGAATACCTGCATCATACAATAACCAGATGCCTT
GGGTATTAACAAAGCCAAGCCGAAGGTGGAGCGAAGAGGAATCCAGATTGAAGACCATTTTTGCCCGAGC
ATTTGCCCTTCATGGGCCGTGTTCATGGTGGAAACCATAAGGGTGTACATTATAATGATACCGCCCAGCG
CAAGGACAGCGGAGTTAAAAACACCAAACATATTGCCCATTATCTGGCTTCCAGTGCCGTGCAATACACC
ATCGACTACACCAAATAGGTTACCTAAAAAAACAACGGACAAATCGCTTGCCGGAGGAGCGAAACTCAAG
GCTCCATTTTCAGCCAGTGCAAGCGCAGGAAAAAAGCAAAGGAGGACCGTAATAGCTAATTTATTCA
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: dotA mutant is unable to replicate in mouse macrophages (Vincent et al., 2006).
References
Vincent et al., 2006: Vincent CD, Buscher BA, Friedman JR, Williams LA, Bardill P, Vogel JP. Identification of non-dot/icm suppressors of the Legionella pneumophila DeltadotL lethality phenotype. Journal of bacteriology. 2006; 188(23); 8231-8243. [PubMed: 16997951].