Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

feoB from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1444
Gene Name feoB from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3079487
NCBI Protein GI 52842863
Locus Tag lpg2657
Protein Accession YP_096662.1
Other Database IDs UniProtKB-ID: FEOB_LEGPH
UniRef100: UniRef100_Q5ZS62
UniRef90: UniRef90_Q5X1N2
UniRef50: UniRef50_Q5WTE1
UniParc: UPI0000442A20
EMBL: AE017354
EMBL-CDS: AAU28715.1
RefSeq_NT: NC_002942.5
GenomeReviews: AE017354_GR
KEGG: lpn:lpg2657
NMPDR: fig|272624.3.peg.2607
eggNOG: COG0370
HOGENOM: HBG731320
OMA: AMMYLMF
ProtClustDB: CLSK833536
BioCyc: LPNE272624:LPG2657-MONOMER
Taxonomy ID 272624
Gene Starting Position 3004192
Gene Ending Position 3006447
Gene Strand (Orientation) -
Protein Name ferrous iron transporter B
DNA Sequence
>gi|52840256:3004192-3006447 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
ATCACGTATTTGCAGCAGCATTTTGCCTCCCCATACCATACTGGCTATAACGAAATACAGCTAAAACAAA
AAGCAGGCTCAGTGACATAGCCAAAATCCAGACCATACTTTGTTGAGGATGATCCAGAAATTTAGCGCCT
TGATAAAAGACAACGGAAGTGGCGTAAGCCACGACAAATGACCAAACAATGGAAGTCCACATAAATCGCT
TGTTTGCCTCCTGGCGAATCACTGCCATAGTCGAAACACAAGGGATATAAAGCAAAACAAAAAGCAAATA
AGCGTAGGCTCCTACAGCTCCATCAAAACGTCGTGACATAATGCCATAGACAGATTGAGATAACTCACTA
TCAGCTGCACTGGCAGAAACAGGGTTCCACAATGCAGAGCCTAATTCAGACAAATTGGCGGGAATAGACC
CAAAAGCAGCTTTGATGCCCCCCCAAAAATCAAAGTGAGCAGCAGCTATTTCTCCCACATGGCCTACTTG
GGCATAAAGTGAGTTTAAGGTGCCAACCACTACCTCTTTAGCCAGCATGCCAGTTAATAAACCGACAGTC
GCGGGCCAGTTGTCTTGATGAATTCCCATTGGAGCAAATAATGGAGTAATCCACTGACCCATTATTGACA
ATAAAGAATCCGTATTGGCTTCTCCGGAGCTAATCCCTCCTCCCCAAGTAATCGCATTTAATCCTCCCAG
AATCACACAAATGGGAATAATCAGCTTACCCGCACGATAAACAAAAAATCGTAATCGCATGGAGGTTTCT
CTCAGCAATCTTCTGAGTGAGGGTCTATGATAGGCGGGTAACTCCAAAATCAAAGGAGAAGCATGTCCTT
TCAACGTAGTTTTGCGTAAAATATATCCGGTAAATACGGCCATTAAAATGCCAATCAAATACAACGAAAA
AACAACATTATGCCCGCCAGAGGGGAAAAAGGCCGCGACAAATACTGCATAAATAGCCAGTCGGGCACTA
CAAGACATAAATGGACTCATCATCACAGTTAATAATCGATCGCGCTCCGAGTCCAGGGTGCGTGCTGCCA
TAATGGCAGGGACATTACATCCAAAACCCACAATCATGGGTACAAATGATTTTCCTGGTAATCCCATGGC
TCGCATCGCTTTATCCACGACAAAAGCAGCTCTTGCCATATAGCCAGAAGTTTCCAATAAGGACAAAAAG
AAAAACATCGCGGCAATCACAGGAATAAAAGTAATAGTGGTATTAATTCCTTTGCCTACCCCATTAGCTA
CAAGCGCGATTACCCAATGTGGTGCATGGAGCTGTTGCAACAACCAACCACTACCCTGAACAAAGATAGT
CTCTGTACTAATGTCAAAAAAATCCTGGAATGCTCCCCCAATATTAATAGCAAACAAAAACATCAAATAC
ATCATCGCAAAAAATATGGGCAAAGCTAAAAAGCGATGCAAAACAAGTTTATCCAATTTAGCAGTGAAGT
GTTCGCTGGCATCACTATGCTTTTTTTGAACCAACGTAACAATTTCATGGATTTTTTGATAGCGAGCGTC
TGCCAGTAACACATCAAGATTTTGCTCCGTTTCTTGAAGCTTTATAAGAAGACTCTCGGTAAAAGCTTTC
TCTCCTATCAAAGTATCCCCTTCGGCAAGCCTACGGGAGAAATAGTAGGCAAAGGAATTTTTATACCCTT
TTGAGATCAGCTGATTTTCCAGGTCATTCAAAATTTGTTGTGCTGCAACCGATAAGGAAAGTTTTAGAGG
TTTTATCTTTTGGGAGCAATGAAGTAATGATTGCTGAAGTGCCGGAATACCAATGTTTTTATGGGCCTGA
ATGGGAATAACAGAACACCCTAACAAACTCTCGAGTTTCTCTGTATCAATAGAAATACCCCGATGCTCGG
CAATATCCATCATGTTAAGTGCTACAACAACAGGTTTACCTAACTCAAAAAGTTGGCTGGTTAAATACAA
ATGTCTTTCAAGGTGACAAGCATCTATAACATTAATGATGCAATCGTATTCCAAATCAATAACTGACTGA
GCAGCAATTTGCTCATCCTGGCTTATTCCTTCGGCATTCGCAACCAGAGAATAGACACCTGGCAAATCAG
TGATTTCAATTAGATGTTCTCCAAGCAAAAATTCACCTGTTTTTTTCTCAACAGTTACTCCGGGCCAGTT
GCCTACGCGTTGATTCGCATTGGTCAAGGCATTGAATAGGGTTGTCTTACCACAATTGGGATTTCCTATT
AATAGGGCATGAGTCA
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: feoB mutant is attenuated in human macrophages (Robey and Cianciotto, 2002).
COG COG0370P, under P: Inorganic ion transport and metabolism
References
Robey and Cianciotto, 2002: Robey M, Cianciotto NP. Legionella pneumophila feoAB promotes ferrous iron uptake and intracellular infection. Infection and immunity. 2002; 70(10); 5659-5669. [PubMed: 12228295].