Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

ptsP from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1445
Gene Name ptsP from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3079830
NCBI Protein GI 52843066
Locus Tag lpg2871
Protein Accession YP_096865.1
Other Database IDs UniProtKB-ID: Q5ZRL0_LEGPH
UniRef100: UniRef100_Q5ZRL0
UniRef90: UniRef90_A5II44
UniRef50: UniRef50_A1TYU3
UniParc: UPI0000442ADF
EMBL: AE017354
EMBL-CDS: AAU28918.1
RefSeq_NT: NC_002942.5
GenomeReviews: AE017354_GR
KEGG: lpn:lpg2871
NMPDR: fig|272624.3.peg.2810
eggNOG: COG3605
HOGENOM: HBG456539
OMA: LGHRLMR
ProtClustDB: CLSK914860
BioCyc: LPNE272624:LPG2871-MONOMER
Taxonomy ID 272624
Gene Starting Position 3247879
Gene Ending Position 3250173
Gene Strand (Orientation) -
Protein Name phosphoenolpyruvate protein phosphotransferase PtsP
DNA Sequence
>gi|52840256:3247879-3250173 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
ATCATGACTTTCCTGCTCTGATTAATCCCCCTAATCCTTCCTCTTCTAGAGCCTTTTGCAAATGAAATCG
TATTTCAGCAGGATGTTCAAATTCCAAAACTTCTGCCAGAATTTTACGGGCATTCGCGATAGCAAAATTG
CGAATAACCCATTTCACCCTGGGTAAACTGGCGGAATTCATGCTTAAGGTGTCAAAACCCATAGCAATTA
ACAAAATCACCGCTAAAGGATCGCTGGCCATTTCGCCACAAATACTCACCTCAACACCAGCCGCATGCCC
TCCTTCGACTATTTTTAGCAATGTACGCAACATGGCTGGATGCAAGGGATCATAAAGTGCGGCAACTCGG
GCGTTATTTCTATCCACAGCCAATAAATATTGGGTAAGATCGTTACTACCCACCGAAATAAAATCTACTC
GTTTCGCCATTTCTCTTGCCAGATAAGCAGCGGCAGGCACTTCAATCATCACACCAATTTTGGGTTTTAC
TATTTCGCACCCCTCTTCCACCAGCTCTTCAAATGCCTGTTCAATCAAATAAACGGCTTCCTCTACTTCG
CTAAGTGTTGTGACCATAGGCAACATGATACGTAAATTATCCAGTTCCTCACTGGCACGCATCATGGCAC
GAACCTGAATCAGGAAGACATCTGGATGATCAAGAGTTATCCTTATTCCACGCCATCCTAAATAAGGGTT
TTCCTCTTCAACTGGAAAATAAGGTAGAATTTTGTCTCCACCAATATCCAGGGTACGCATAGTCACCAAA
CGTGGAGCAAAGGCCTTGAGAGTCTGTCTGTAAATAATGGTCTGCTCATCTTCTGAAGGGAATCGATCTC
GACTCATAAATGGTACTTCTGAACGGTATAAACCAACTCCTTCAGCGCCAACACTCATTGATAAACCGGC
ATCCATTGCCAAGCCGGTATTGACTTGCAAAGAGACTCTGTAGTTATCAGTAGTTTCAGCTGGTTTATCA
CGCAAGCTTACCAGGCTTTGGTTTAATTCCTGTTCTTCTTGAGCTAATTGCTTAAATTCCGCTAATAATG
ATTTGGAAGGAGAGATATAAACATGCCCATAATAGCCATCAACAATCAAAGCCCGACGCGATACCAACTC
TACTTTTAATCCTCTCAACCCCATCACAGTAGGTACACCGAGAGCTCTCGCTAAAATAGCAACATGGGAG
TTATTGGAGCCTTTAGCTGAAACGACACCAGCCAATTGCCCTTCTGGAACTTCTGCCAGAGCGGCAGCAG
TAATTTCTTCTCCTATTAAAATGGTTCTCTTCGGATAAACAATTTCTTCTCTTTGGGTACGTTGTAATTC
CGCCAAAACTCTTCGGCCCAAATCACGGAAATCGCTGGCTCGTTCGCGCAGATAATCATCGCCCATGCTT
TCAAATTGCTGCACGTGTTTCTTGATCACTGTAGCCAGGGCAGCTTGAGCGCTGATTTTCTCTTCACGAA
TCACATGCTCTACTTCAGCACCCAAGCTATCCCTATCCAAAATTCTTAAATACACATCGAATAAAGCATG
CTCTTCCTCAGCAACAGTTTCTTTCATGCGTTTACTTAAACGCCTGATATCATCTCTTGTCGTTTCCAAA
GCTTCATAAAACGCATTGATTTCATCTTCCAATTCTTCAACCGGATTACGAGGGACAGCATCAATATCCG
CAGGTGGGTACACAACCACGGCAGTACCAATTCCTATACCAGGAACACTGCCTATTCCAGTCAGTGCAGT
ATAAGTCGCTTCTACCTTGTCGACGCCTATACCCTTTTTAGGTTGTGTTAACTCGGCCAATTCACCTGTT
GCCTCTGCATGAGCAATAATCCCGCCTAATTGAGCCGCCAAGGTAATAAGAAATGATTCTTCAGCATCAT
CAAAATAACGTTGTTCAAGCTGTTGTACAACTAAAACACCGTATAATTTTCTATGTTGAATAATAGGGAC
GCCTAAAAAAGCGTTCAGGTGATCTTCGCCGATTAATGGATTATGATAAAAATCCGGATGAGAGGGAGCA
TTTTCTATATTGATAGGTTCCTCTCTTCGTCCTATCAACCCGATAAGACCGCAATCAAGAGCAATTCTGA
CTCTAAACTCTGCCTGCTTGTTCAAACCTTCCGTGGCTATCAATACGTATTCAGCATTTTTATTATCAAT
AAGATAAACGGAAACAGCCTCTGCATTAATGGCTGTATTAATACGTTGCACCAAAATGCCAAGTGCTTCT
TTCAAATCACTGGCAGCGGTAACATCTTGTACTATCCGTTTAAGTATTTTAAGCA
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: ptsP mutant is attenuated in guinea pigs (Higa and Edelstein, 2001).
COG COG3605T, under T: Signal transduction mechanisms
References
Higa and Edelstein, 2001: Higa F, Edelstein PH. Potential virulence role of the Legionella pneumophila ptsP ortholog. Infection and immunity. 2001; 69(8); 4782-4789. [PubMed: 11447151].