Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

icmG from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1446
Gene Name icmG from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3079958
NCBI Protein GI 52840697
Locus Tag lpg0452
Protein Accession YP_094496.1
Other Database IDs UniProtKB-ID: Q5ZYC0_LEGPH
UniRef100: UniRef100_Q5ZYC0
UniRef90: UniRef90_Q5ZYC0
UniRef50: UniRef50_D3HL98
UniParc: UPI00000B2502
EMBL: AE017354
EMBL-CDS: AAU26549.1
RefSeq_NT: NC_002942.5
TCDB: 3.A.7.9.1
GenomeReviews: AE017354_GR
KEGG: lpn:lpg0452
NMPDR: fig|272624.3.peg.2065
eggNOG: NOG84452
HOGENOM: HBG520087
OMA: IARQSEV
ProtClustDB: CLSK914912
BioCyc: LPNE272624:LPG0452-MONOMER
Taxonomy ID 272624
Gene Starting Position 490585
Gene Ending Position 491394
Gene Strand (Orientation) +
Protein Name IcmG (DotF)
DNA Sequence
>gi|52840256:490585-491394 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
AATGATGGCAGAGCACGATCAAAATAATGATGAATATAAATTTGCAGAACTTGACTCATACGATATGGAT
CAGGCTGGTGAATCGGATCTCGATTCAGAAGCCTCGTATCAATCTGGGAAAGAGGGATTAACAAAGAAAA
AAGATATTAAGCGAAATGCTCTTATTGCTATTGGGGCAGTTGTATTTATAATGGTGATGTATAAAATAAT
TGGTTGGATGTTTTTCTCAGACAAATCCAGCCAAGTAACCTCAAAGCCCGCTATTCCTCCGGTGACACAG
GTAGCAACACCACAACCTGTACAGACAATACCAACCACCACTCCCATACAACAAGTTCAGCCTACGACTA
TTATTGAAGATGACCCCGATCTAAAGAAGAAAGTTTCAGCAATAGAAATGACACAGCAGAGTCTTCGTTC
TGAAGTCAATGCCCTTAGTGAGCAAATTAATGCAGTAAATAATAATATCAAAAATTTAAATGCTCAAATT
GTAAATCTGAATCAAATTATTGGTAATATGTCAAATCAAATTGCTAGACAATCAGAAGTGATTAATGTCT
TAATGGCACGTACAACACCTAAGAAAGTTGTAAAAGTGTCTCGGCCAATAGTTCAAGCAAGAATTATTTA
TTACATACAAGCAGTAATTCCAGGTCGGGCTTGGCTAATTGGCTCAAATGGTTCTACACTTACAGTTAGA
GAGGGATCAAAAATTCCAGGATATGGAATGGTTAAATTAATTGATTCTTTGCAAGGTCGTATTTTAACAA
GTTCTGGACAAGTGATTAAGTTTAGTCAAGAAGATAGTTG
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: icmG mutant is attenuated in guinea pigs (Edelstein et al., 1999).
References
Edelstein et al., 1999: Edelstein PH, Edelstein MA, Higa F, Falkow S. Discovery of virulence genes of Legionella pneumophila by using signature tagged mutagenesis in a guinea pig pneumonia model. Proceedings of the National Academy of Sciences of the United States of America. 1999; 96(14); 8190-8195. [PubMed: 10393970].