Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

icmB from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1447
Gene Name icmB from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3080126
NCBI Protein GI 52840701
Locus Tag lpg0456
Protein Accession YP_094500.1
Other Database IDs UniProtKB-ID: Q5ZYB6_LEGPH
UniRef100: UniRef100_Q5ZYB6
UniRef90: UniRef90_Q5ZYB6
UniRef50: UniRef50_A5IHD8
UniParc: UPI00000BD1F2
EMBL: AE017354
EMBL-CDS: AAU26553.1
RefSeq_NT: NC_002942.5
TCDB: 3.A.7.9.1
GenomeReviews: AE017354_GR
KEGG: lpn:lpg0456
NMPDR: fig|272624.3.peg.2069
eggNOG: NOG47700
HOGENOM: HBG376707
OMA: ELWAFST
ProtClustDB: CLSK861735
BioCyc: LPNE272624:LPG0456-MONOMER
Taxonomy ID 272624
Gene Starting Position 493270
Gene Ending Position 496299
Gene Strand (Orientation) +
Protein Name IcmB (DotO)
DNA Sequence
>gi|52840256:493270-496299 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
GATGGCAAATTGGTCAGAATCGTTTTTTGAAGGCGTCGATACTTTCTTTGCCTGGTTAAGTACTTCCTTG
AAGCAAACTACAGAGTCTTATATAGATTTGGAAACGGCGGATAGCCCTACCGTATTAGTTAATCATGATG
GATCATTACTGTCGGTATTAAAAATTGAAGGGATTACTGGATTGGCAGGCCCTGAAGAGTTTGAACGACT
CGTTGAAGGTTTAGCCAACTCATTTCAAGCTGCTATGGGTAGACCTGGTCATGCGCTACAAGTTTATTTT
AGCCATGATAAGCAAAACATAGTAAAAATGATCAAGGATATTTATGACCCTGCGGAAGCAACAGCAAGTC
GTCTTGAACTTAATTTAAGAGATTTATTTGAGGAGCGGGTCAATTATTTATCACAATATTGTGCAGAGGA
GCGTGTTTATTTTGTTTTGTATACAAGACCATTTAACTTGGCGAGCGATCAGTTAAAAGCTGCGAACAAA
GCAAAAATGAAGATGATCAAGGATACAAAAGCTCCTCCATTTAAAAACACACAAACGATTTTTGCGGCTG
TTCCGGAAATAAGAGATACACATGATGCTTATGTGCGTGCAATTCTAAATGATTTGGATGCCCTTAATGT
GATAGCTAAGTTGCTTGAGGTGCACGATGCAGTACATGCCATTCGCATGACAGGTGATCCTGATTATACT
GCAGATGATTGGCGCGCAACTTTACCTGGAGATAAAATACCTGTTCGCGAGCTGAATAATTTTGAGGGGG
ATCCTTCTGATTTATTATGGCCGCCGTTGTCCAGGCAGGTTTTGCCAAGAGATGCAGAGATTATTGATTT
ACGCACTGTCCGAGTGGGCGATAAAATTTATGCTTCAACCTATATTGATTTGTTTCCAAAGGATGTAAGA
CCATTTATTAGTTTATTTTCTCGTATTCTTCCTTCACATGTGCCCTGGAAAATTTCTTTTTTGCTAGAAA
GCGAAGGATTAAGCACAATTAAATTGAAGGGGCTCTTGGCAGCGATATTGAGCTTTAGCTCTGCACAGAA
TCGTTTAATTAGTGATTCGGTTAATCTGCTGAAATATATACAACTCAATACTGATGAGGCGATTGTAAGA
CTACGCGTCGTTGCAACAACCTGGGCTCCTGAAGGCAATATTCCCTTGTTGCGGCGGAGAAGTTCTGAGT
TAGTAAAGGCTATTGAAGGTTGGGGTTCTACTGATGTATCAGAGATTTGTGGGGATCCGTTTGCAGGCTT
TGTGTCAAGTATGCTAGCTACTACTTTGAACAGCTCAGCAGTAGCATCAGTAGCTCCTTTGTCAGACGTT
ATCTCAATGCTGCCTATTACAAGACCAGCATCTCCCTGGAAAACAGGAGCCTTGCTTTTTAGAACACCAG
ATGGTAAACCGTGGCCGTTTCAACCAGGCTCAACTGAACAAACTACTTGGATTGATCTGGTTTACGCTCG
TCCTGGTTCTGGTAAATCTGTGTTGTCAAATGCACTGAATTTAGCTCTTTGTCTTTCAGGTGGTTTAATG
CGTTTGCCGCGCATAGCAATTATTGATATAGGCCCCTCAAGTAGCGGTTTGATTTCATTGTTAAAAGAGG
CTCTCCCTGCATCTAAGCGTCATTTGGTTGCTTATCATAGATTAAGGATGACCCCAGATTATTCGATTAA
TCCCTTTGATACCCAATTGGGATGTCGTTATCCAACTGCTTTGGAACGATCATTCTTAGTCAACTTCATG
ACCTTGCTAACTACGCCATTAGGTGCTGCAAAGCCATATGACGGTATGGCAGATTTGGCGGGTATGGTGG
TAGATGAATTATATAAAAGCATGGCTGATGAATTCAATCCGACACCCTATGCTCCAGGAATAGAGGAATT
TATCGATGGCATCCTGGAGGAAATAGGCTTTGTCCGAGATGCCAAATCAACCTGGTGGGAAGTGACGGAC
GCGCTCTATTCAGCAGGTTTTGTTCATGAGGCGATGTTAGCGCAAAGATATGCAATGCCGTTATTAGCGG
ATGCTGCTTCTATCTGTAGAACACCATCAATTGAGGATTTATATGAAAAGATTACGGCGCCAACTGGTGA
ATCACTAATTAATGCTTTTTCAAGAATGATTTCATCAGCTGTTCGCGAATATCCTATTTTATCACGGGTC
ACTAGTTTTGATATTGGTGACGCAAGAGTAGTGTCTCTTGATTTGGATGAAGTAGCGAAAAGTGGTGGTG
ATGCGGCAGATAGACAAACAGCGGTTATGTATATGCTAGCCAGATATGTATTGGCAAGGCACTATTATTT
AACAGAAGAAAGTTTGAATAATGTACCGGAACAATATAAAGAGTATCACAAACAGAGAGTATTAGAGATT
CGAGAAGATCATAAGCGTATTGTTTATGATGAATTCCATCGCACGGCAAAATCGTCTGCTGTTCGTGAGC
AAGTTATTATTGATATGCGTGAAGGCCGAAAATGGAAAGTGCAAATTTCCTTATTATCACAAGCAGTAGA
TGACTTTGATCCGGTAATGATTGATTTTGCTACCGCTATTTATGTTATGGATGCAGGACCATCTCAAGCT
GTCGAGAAGACCAGTCAAATTTTTGGACTTTCTGAAACAGCCAAGATTGCGTTACGTACTCGAGTTCATG
GTCCTAGACAAGGTGGCGCTACTTTCCTTGCTCAGTTTGCTACTAAAACAGGTATCAACGTACAATTATT
AACCTTAACATTGGGCCCGGTCGAATTATGGGCATTTAGTACTACTGCAGAAGATGCCACAGTACGAAAT
CTTTTGTATAGGCATCTGGGACCAAGTGAAGCTCGACGGCTTTTAGCTGCACTGTTCCCAAATGGTACAG
TGACTAAAGAATTGGAGGCTCGATTAGCAAGCATGAAGCAAAAAGTTGGGTTAATTGAAGACGATGAGAG
AGAGGGAATGATTAACCAATTGGTGAATGATATTCTTGATGCTTATTCAAAAGATCCCAACGTGAAAAGC
TTGCCTGCAAAAGTAGGTTG
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: icmB mutant is attenuated in guinea pigs (Edelstein et al., 1999).
References
Edelstein et al., 1999: Edelstein PH, Edelstein MA, Higa F, Falkow S. Discovery of virulence genes of Legionella pneumophila by using signature tagged mutagenesis in a guinea pig pneumonia model. Proceedings of the National Academy of Sciences of the United States of America. 1999; 96(14); 8190-8195. [PubMed: 10393970].