Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

rpoS from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1448
Gene Name rpoS from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3080381
NCBI Protein GI 52841515
Locus Tag lpg1284
Protein Accession YP_095314.1
Other Database IDs UniProtKB-ID: Q5ZW04_LEGPH
UniRef100: UniRef100_Q5ZW04
UniRef90: UniRef90_Q5ZW04
UniRef50: UniRef50_P35540
UniParc: UPI000044250F
EMBL: AE017354
EMBL-CDS: AAU27367.1
RefSeq_NT: NC_002942.5
GenomeReviews: AE017354_GR
KEGG: lpn:lpg1284
NMPDR: fig|272624.3.peg.2339
eggNOG: COG0568
HOGENOM: HBG745096
OMA: LEAPARE
ProtClustDB: CLSK832699
BioCyc: LPNE272624:LPG1284-MONOMER
Taxonomy ID 272624
Gene Starting Position 1411961
Gene Ending Position 1413040
Gene Strand (Orientation) +
Protein Name stationary phase specific sigma factor RpoS
DNA Sequence
>gi|52840256:1411961-1413040 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
CTTGTTAAGAAGTAAAAAACTATTTCAAGGCATAGCTAAACATATAGGTGATACAATGCAAGATGATGAA
GAGCCAATTAAGGACAAGGAATTTAAAGAAGAGGAATGGTCTGAGCCAGATGATGAATCTCTGTTGTCAG
AAGAAGATGTTGAACCTGATATCGAAAAAATGGAAGAAGAGCTTGATGAACTTCCAGAGTTTACTGATGA
TGAAACTTTTCCTTCATTCCAGCGCGGGAAAAATATTGCCAAGGCTTTAGATGCGACTCAACTTTACTTG
GGTGAAATTGGTTTTTCTCCTTTGTTAACGGCTGAAGAAGAAATCCATTATGCGACTCTTGCTTTAAAAG
GTGATATGGAAGCACGCAAGAAAATGATTGAGTCGAATTTGCGCCTGGTGGTTAAAATAGCCAGACGTTA
TCTTAATAGAGGATTGCCTCTTCTTGATCTAATCGAAGAGGGTAACCTGGGTTTAATGAAGTCTGTTGAG
AAATTTGACCCCAAGCGAGGATTCCGTTTTTCAACTTATGCGACCTGGTGGATTAGGCAAACTATTGAGC
GCGCAATTATGAATCAAACGAGAACTATCCGTTTGCCTATTCATGTCGTGAAAGAACTTAATGTTTATCT
CAGAGCGGCAAGGCAATTGACGCAAAAACTGGATCATGAACCATCACCTGAAGAAATAGCAGAAATGGTG
GATAAGCCTTTGGAGGATGTCCAAAAATTATTGGGATTGAATGATAAAGTCGCTTCAGTTGATACTCCAA
TTGGATTTGATGAAACCAAATCTTTATTAGATACAATTGCTGATGAAAACAGTTTAAATCCTGCAGAGCT
GCTAACCAATGAGAATTTAAGGCAGCATATAGAATCTCTTCTGGATAAATTAACTGAGAATCAACAGCAG
GTTATCGCAAGACGTTTTGGGTTAAGAGGTTTTGAAAAAGCGACACTGGAAGACGTTGGTAAGGAAATTG
ATTTGACCCGAGAACGCGTTCGCCAAATTCAAGTTGAAGCGTTGAAGACACTTAGAACTTTGTTAGAGCG
GGTTGGACTAACACAAGAGGATTTGTTTTG
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: rpoS mutant is defective in intracellular replication in its protozoan host (Hovel-Miner et al., 2009).
COG COG0568K, under K: Transcription
References
Hovel-Miner et al., 2009: Hovel-Miner G, Pampou S, Faucher SP, Clarke M, Morozova I, Morozov P, Russo JJ, Shuman HA, Kalachikov S. SigmaS controls multiple pathways associated with intracellular multiplication of Legionella pneumophila. Journal of bacteriology. 2009; 191(8); 2461-2473. [PubMed: 19218380].