Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

djlA from Legionella pneumophila subsp. pneumophila str. Philadelphia 1

Victor ID 1449
Gene Name djlA from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Sequence Strain (Species/Organism) Legionella pneumophila subsp. pneumophila str. Philadelphia 1
NCBI Gene ID 3080541
NCBI Protein GI 52842551
Locus Tag lpg2341
Protein Accession YP_096350.1
Other Database IDs UniProtKB-ID: DJLA_LEGPH
UniRef100: UniRef100_Q9X772
UniRef90: UniRef90_Q9X772
UniRef50: UniRef50_Q9X772
UniParc: UPI00000BB2C4
EMBL: AJ011775
EMBL: AE017354
EMBL-CDS: CAB43070.1
EMBL-CDS: AAU28403.1
RefSeq_NT: NC_002942.5
GenomeReviews: AE017354_GR
KEGG: lpn:lpg2341
NMPDR: fig|272624.3.peg.76
eggNOG: COG1076
HOGENOM: HBG508481
ProtClustDB: PRK09430
BioCyc: LPNE272624:LPG2341-MONOMER
Taxonomy ID 272624
Gene Starting Position 2644093
Gene Ending Position 2644989
Gene Strand (Orientation) +
Protein Name Dna-J like membrane chaperone protein
DNA Sequence
>gi|52840256:2644093-2644989 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 chromosome, complete genome
TCTGATAATGAACTTACGCGATTTCTTTGTAATAACAACCTGGTGGGGAAAAATACTTGGTGCCTTCTTT
GGCTACTTAACTGCTGGGCCAGTAGGCGCTTTGTTTGGCATTCTCGTTGGAAACTTTTTTGATCGGGGCC
TTGTCAGTTATTACTCTAATCCCCATTGGCTGTACCATGCAGAAAAACAAAGAATCGTTCAAAAAGCTTT
CTTTGAAGCCACTTTCTCCATAATGGGGCATGTTGCGAAATCGGATGGCCGTGTTTCTGAACAAGAGATT
AGCATGGCTAAATCCATCATGAATGAAATGAAATTGAGCAAGGGGCAAAAGGATTTGGCAAAACGATTAT
TTAATGAAGGGAAACAAGCTGATTTCAATGTCAGTCTTGCTCTTATCCAATTACAAAGAATCTGCAAGGA
TAACCGTGATTTGTTAAAGCTTTTTGTAGATATTCAGTATAGGGCAGCTCAAGTAGATGGATTAAGTAGT
CAAAAAATTCACGCACTAGATAACATTTTTACGCATCTGGGATTTGCTCCCCTACACAAACAGTATCGTT
TTTATGAGGATTTTGGTTCTTATTTCCAGCAAGAACAATCCAAACAACACTATCATAATCAACAGGAGTA
CAAGCATACCTCCTCATCTCAAGGTCAACAGGGTTACAAACCTCAATCACCCCCTAATACTTTAGCCCAT
GCTTTTGCATTACTTGAGGTAAGTCCGAATGCAAACAAACAGGAGGTTAGAAGAGCGTACAGACGTCTAT
TGAGCCGTAACCATCCAGATAAATTAATTGCTCAAGGTTTACCCGAAGAAATGATTAAATTGGCTAACGA
TAAAACTCATCAAATTATGAAAGCCTATGAATTGATCTGTGAAACCAAGGGTTGGTA
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: djlA mutant is attenuated in mouse macrophages (Vincent et al., 2006).
References
Vincent et al., 2006: Vincent CD, Buscher BA, Friedman JR, Williams LA, Bardill P, Vogel JP. Identification of non-dot/icm suppressors of the Legionella pneumophila DeltadotL lethality phenotype. Journal of bacteriology. 2006; 188(23); 8231-8243. [PubMed: 16997951].