Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

plaB from Legionella pneumophila str. Lens

Victor ID 1452
Gene Name plaB from Legionella pneumophila str. Lens
Sequence Strain (Species/Organism) Legionella pneumophila str. Lens
NCBI Gene ID 3113555
NCBI Protein GI 54294354
Locus Tag lpl1422
Protein Accession YP_126769.1
Other Database IDs UniProtKB-ID: Q5WWN0_LEGPL
UniRef100: UniRef100_Q5WWN0
UniRef90: UniRef90_A5IC98
UniRef50: UniRef50_D3HQ45
UniParc: UPI000044581E
EMBL: CR628337
EMBL-CDS: CAH15662.1
RefSeq_NT: NC_006369.1
GenomeReviews: CR628337_GR
KEGG: lpf:lpl1422
NMPDR: fig|297245.3.peg.2722
LegioList: lpl1422
eggNOG: NOG14116
HOGENOM: HBG520456
OMA: PANHGSA
ProtClustDB: CLSK929571
BioCyc: LPNE297245:LPL1422-MONOMER
Taxonomy ID 297245
Gene Starting Position 1588072
Gene Ending Position 1589496
Gene Strand (Orientation) -
Protein Name phospholipase
DNA Sequence
>gi|54292964:1588072-1589496 Legionella pneumophila str. Lens, complete genome
ATCAATCTATCTTTTTCCCAGTTGGCTTTCCACTGATTTTTGCCGGAGTAAGGTTGTTGTTGATGCGGAA
AACTGTCCTATCTACTCGTCTTTGCAGCATGATTTCAATCATTACGGTTTCATTCGGATGAAGTATTTTG
TGAATGTCAGCAAGCGATGAATGAAAATCAAGTAACCTGTAATAGGCAAGGGCTTGCTCACTTGATTCAG
GATATGCTTTAACACGGAACCCAAGATTACCCTGCATTTTTGGGGTATTAATTCCACCTTCCATGATATC
GTAGTCAAGAAAATAAGTCAGTTTACCTCGATTATTGAGATTTCGCTGACGATCTACAAAAAAACCTGCA
GGAAGCGCCTGCTCGCTATATTGAGGTCCGGCAGTTAGGTAAAGATCATAATCGATAAGGTGATTGCCGC
GGTCATCAATGAGCCGGAAAATAATCATAGAGTAACGATTGGTTATATACTCACGCGTAAAGACAAGTGT
TTTCACAAACTCCTTGTGCTCATTTTTCTGAGTCTCTTTAGTAATATTATCCAACTCTTTTACTAATTTA
TTATAGGAGTCACGACTTTTTACTTGCAGACATCGCAAGACCCATATTGCAGTGGGGTGAGTGGCTGCAT
TGGCCATAGTAATACTACGGATGATACCGATATTTTTACCGGAATGTGAAAGTCCAGGTAGAACTCCAAA
TGCCATTGGCTGTGTTCGTGTCATTTTGGCGACAACAAGGCTTTCACCGTTATCCCCCTCCTGATGTAAT
TTCAATAAGCTATAATTCATATTTGTTGCAGCAACGCGTACCACCCCATCGGATCCGGATTCTCCTGTGT
AGGAGTTCACTGCATCATAAAGTTGGCGATCAATTTTCTGGCCAGTAAGTACAAAAGAATAGACACCATT
GGCAGTACAATCATAATCAAGCCAGCTTTCATTAAGTTGCCAGCTCATATCGCTTCCGAGTTCAAGCCAA
TCAAGTACACACTTTCCCGGTTCAATGCCTTCAAAAAAACTCTTTATGCGGCCTAGCCGGGATTTACCAA
GTTGAGCAAGAGCAGAACCGTGGTTGGCAGGAGCCAGCATGATAAGGTGACTCAACGGACATTTTGCAAG
ATTATTTTTAAAGTATAAATCCATCCATTTGCGGACAATGGGTCCACCAGTAGAGTGAGTGATACAAGCA
AAACGCTGCCCATCTTTTACTTTATCAGCAATTTCATCACGTACCGCTTGATCAAATGCGCGTGCTATAT
CGTCAATCGTCACCGTATCATCAAAACTAATATAGCGCCCAAGATAAATATTGCCGACTTGAATATCCAG
CTTTCCCTGTTTACTCTGATTTTCAAGCCATTGAGGAAGTTCCCCATAAGTATTGGTATGCGTGACACTC
CAGCCATGGACGAAGATAACAATCA
Protein Sequence
>gi|54294354|ref|YP_126769.1| phospholipase [Legionella pneumophila str. Lens] MIVIFVHGWSVTHTNTYGELPQWLENQSKQGKLDIQVGNIYLGRYISFDDTVTIDDIARAFDQAVRDEIADKVKDGQRFACITHSTGGPIVRKWMDLYFKNNLAKCPLSHLIMLAPANHGSALAQLGKSRLGRIKSFFEGIEPGKCVLDWLELGSDMSWQLNESWLDYDCTANGVYSFVLTGQKIDRQLYDAVNSYTGESGSDGVVRVAATNMNYSLLKLHQEGDNGESLVVAKMTRTQPMAFGVLPGLSHSGKNIGIIRSITMANAATHPTAIWVLRCLQVKSRDSYNKLVKELDNITKETQKNEHKEFVKTLVFTREYITNRYSMIIFRLIDDRGNHLIDYDLYLTAGPQYSEQALPAGFFVDRQRNLNNRGKLTYFLDYDIMEGGINTPKMQGNLGFRVKAYPESSEQALAYYRLLDFHSSLADIHKILHPNETVMIEIMLQRRVDRTVFRINNNLTPAKISGKPTGKKID
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: plaB mutant is attenuated in guinea pigs (Schunder et al., 2010).
References
Schunder et al., 2010: Schunder E, Adam P, Higa F, Remer KA, Lorenz U, Bender J, Schulz T, Flieger A, Steinert M, Heuner K. Phospholipase PlaB is a new virulence factor of Legionella pneumophila. International journal of medical microbiology : IJMM. 2010; 300(5); 313-323. [PubMed: 20153694].