Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

ptsP from Legionella pneumophila str. Lens

Victor ID 1453
Gene Name ptsP from Legionella pneumophila str. Lens
Sequence Strain (Species/Organism) Legionella pneumophila str. Lens
NCBI Gene ID 3113668
NCBI Protein GI 54295696
Locus Tag lpl2784
Protein Accession YP_128111.1
Other Database IDs UniProtKB-ID: Q5WSU2_LEGPL
UniRef100: UniRef100_Q5WSU2
UniRef90: UniRef90_A5II44
UniRef50: UniRef50_A1TYU3
UniParc: UPI0000445CC4
EMBL: CR628337
EMBL-CDS: CAH17027.1
RefSeq_NT: NC_006369.1
GenomeReviews: CR628337_GR
KEGG: lpf:lpl2784
NMPDR: fig|297245.3.peg.1639
LegioList: lpl2784
eggNOG: COG3605
HOGENOM: HBG456539
OMA: LGHRLMR
ProtClustDB: CLSK914860
BioCyc: LPNE297245:LPL2784-MONOMER
Taxonomy ID 297245
Gene Starting Position 3181124
Gene Ending Position 3183418
Gene Strand (Orientation) -
Protein Name phosphoenolpyruvate-protein phosphotransferase PtsP
DNA Sequence
>gi|54292964:3181124-3183418 Legionella pneumophila str. Lens, complete genome
ATCATGACTTTCCTGCTCTGATTAATCCCCCTAATCCTTCCTCTTCTAGAGCCTTTTGCAAATGAAATCG
TATTTCAGCAGGATGTTCAAATTCCAAAACTTCTGCCAGAATTTTACGGGCATTCGCGATAGCAAAATTG
CGAATAACCCATTTCACCCTGGGTAAACTGGCGGAATTCATGCTTAAGGTGTCAAAACCCATAGCAATTA
ACAAGATCACCGCTAAAGGATCGCTGGCCATTTCGCCACAAATACTCACCTCAACACCAGCTGCATGCCC
TCCTTCGACTATTTTTAGCAATGTACGCAACATGGCTGGATGCAAGGGATCATAAAGTGCGGCAACTCGG
GCATTATTTCTATCCACAGCCAATAAATATTGAGTAAGATCGTTACTACCCACCGAAATAAAATCTACTC
GTTTCGCCATTTCTCTTGCCAGATAAGCAGCGGCAGGCACTTCAATCATCACACCAATTTTGGGTTTTAC
TATTTCGCACCCCTCTTCCACCAGCTCGTCAAAAGCCTGCTCAATCAAATAAACGGCTTCTTCTACTTCG
CTAAGTGTTGTGACCATAGGCAACATGATACGTAAATTATCCAGTTCCTCACTAGCACGCATCATGGCAC
GAACCTGAATCAGGAAGACATCTGGATGATCAAGAGTTATCCTTATTCCACGCCATCCTAAATAAGGGTT
TTCCTCTTCAACTGGAAAATAAGGTAGAATTTTGTCTCCACCAATATCCAGGGTACGCATAGTTACCAAA
CGTGGAGCAAAGGCCTTGAGAGTCTGTCTGTAAATAATGGTCTGCTCATCTTCTGAAGGGAATCGATCTC
GACTCATAAATGGTACTTCTGAACGGTATAAACCAACTCCTTCAGCGCCAACACTCATTGATAAACCGGC
ATCCATTGCCAATCCGGTATTGACTTGCAAAGAGACTCTGTAGTTATCAGTAGTTTCAGCTGGTTTATCA
CGCAAGCTTACCAGGCTTTGGTTTAATTCCTGTTCTTCTTGAGCTAATTGCTTAAATTCCGCTAATAATG
ATTTGGAAGGAGAGATATAAACATGCCCATAATAGCCATCAACAATCAAAGCCCGACGCGATACCAATTC
TACTTTTAATCCTCTCAACCCCATCACAGTAGGTACACCGAGAGCTCTCGCTAAAATAGCAACGTGGGAG
TTATTGGAGCCTTTAGCTGAAACGACACCAGCCAATTGCCCTTCTGGAACTTCTGCCAGAGCGGCAGCAG
TAATTTCTTCTCCTATTAAAATGGTTCTCTTCGGATAAACAATTTCTTCTCTTTGGGTACGTTGTAATTC
CGCCAAAACTCTTCGGCCCAAATCACGGAAATCGCTGGCTCGTTCGCGCAGATAATCATCGCCCATGCTT
TCAAATTGCTGCACGTGTTTCTTGATCACTGTAGCCAGGGCAGCTTGAGCGCTGATTTTCTCTTCACGAA
TCACATGCTCTACTTCAGCACCCAAGCTATCCCTATCCAAAATTCTTAAATACACATCGAATAAAGCATG
CTCTTCCTCAGCAACAGTTTCTTTCATGCGTTTACTTAAACGCCTGATATCATCTCTTGTCGTTTCCAAC
GCTTCATAAAACGCATTGATTTCATCTTCCAATTCCTCAACCGGATTACGAGGGACAGCATCAATATCCG
CAGGCGGGTACACAACCACGGCAGTACCAATTCCTATACCAGGAACACTGCCTATTCCAGTCAGTGCAGT
ATAAGCCGCTTCTACCTTGTCGACTCCTATACCCTTTTTAGGTTGTGTTAACTCGGCCAATTCACCTGTT
GCCTCTGCATGAGCAATAATCCCGCCTAATTGGGCCGCCAAGGTAATAAGAAATGATTCTTCAGCATCAT
CAAAATGACGCTGTTCAAGCTGTTGAACAACTAAAACACCGTATAATTTTCTATGTTGAATAATAGGGAC
GCCTAAAAAAGCGTTCAGGTGATCTTCACCAATTAATGGATTATGATAAAAGTCTGGATGAGAGGGAGCA
TTTTCTATATTGATAGGTTCCTCTCTTCGTCCTATCAACCCGATAAGGCCACAATCAAGAGCAATTCTGA
CTCTAAACTCTGCCTGCTTGTTCAAACCTTCCGTGGCTATCAAGACGTATTCAGCATTTTTATTATCAAT
AAGATAAACGGAAACAGCCTCTGCATTAATGGCTGTATCAATACGTTGCACCAAAATGCCAAGTGCTTCT
TTCAAATCACTGGCAGCGGTAACATCTTGTACTATCCGTTTAAGTATTTTAAGCA
Protein Sequence
>gi|54295696|ref|YP_128111.1| phosphoenolpyruvate-protein phosphotransferase PtsP [Legionella pneumophila str. Lens] MLKILKRIVQDVTAASDLKEALGILVQRIDTAINAEAVSVYLIDNKNAEYVLIATEGLNKQAEFRVRIALDCGLIGLIGRREEPINIENAPSHPDFYHNPLIGEDHLNAFLGVPIIQHRKLYGVLVVQQLEQRHFDDAEESFLITLAAQLGGIIAHAEATGELAELTQPKKGIGVDKVEAAYTALTGIGSVPGIGIGTAVVVYPPADIDAVPRNPVEELEDEINAFYEALETTRDDIRRLSKRMKETVAEEEHALFDVYLRILDRDSLGAEVEHVIREEKISAQAALATVIKKHVQQFESMGDDYLRERASDFRDLGRRVLAELQRTQREEIVYPKRTILIGEEITAAALAEVPEGQLAGVVSAKGSNNSHVAILARALGVPTVMGLRGLKVELVSRRALIVDGYYGHVYISPSKSLLAEFKQLAQEEQELNQSLVSLRDKPAETTDNYRVSLQVNTGLAMDAGLSMSVGAEGVGLYRSEVPFMSRDRFPSEDEQTIIYRQTLKAFAPRLVTMRTLDIGGDKILPYFPVEEENPYLGWRGIRITLDHPDVFLIQVRAMMRASEELDNLRIMLPMVTTLSEVEEAVYLIEQAFDELVEEGCEIVKPKIGVMIEVPAAAYLAREMAKRVDFISVGSNDLTQYLLAVDRNNARVAALYDPLHPAMLRTLLKIVEGGHAAGVEVSICGEMASDPLAVILLIAMGFDTLSMNSASLPRVKWVIRNFAIANARKILAEVLEFEHPAEIRFHLQKALEEEGLGGLIRAGKS
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: ptsP mutant is attenuated in guinea pigs (Higa and Edelstein, 2001).
COG COG3605T, under T: Signal transduction mechanisms
References
Higa and Edelstein, 2001: Higa F, Edelstein PH. Potential virulence role of the Legionella pneumophila ptsP ortholog. Infection and immunity. 2001; 69(8); 4782-4789. [PubMed: 11447151].