Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

dotA from Legionella pneumophila str. Lens

Victor ID 1454
Gene Name dotA from Legionella pneumophila str. Lens
Sequence Strain (Species/Organism) Legionella pneumophila str. Lens
NCBI Gene ID 3113684
NCBI Protein GI 54295526
Locus Tag lpl2613
Protein Accession YP_127941.1
Other Database IDs UniProtKB-ID: Q5WTB2_LEGPL
UniRef100: UniRef100_Q5WTB2
UniRef90: UniRef90_Q5ZS33
UniRef50: UniRef50_Q5ZS33
UniParc: UPI0000445C3B
EMBL: CR628337
EMBL-CDS: CAH16854.1
RefSeq_NT: NC_006369.1
GenomeReviews: CR628337_GR
KEGG: lpf:lpl2613
NMPDR: fig|297245.3.peg.1452
LegioList: lpl2613
eggNOG: NOG41268
HOGENOM: HBG520268
OMA: LQASERI
ProtClustDB: CLSK833557
BioCyc: LPNE297245:LPL2613-MONOMER
Taxonomy ID 297245
Gene Starting Position 2981171
Gene Ending Position 2984352
Gene Strand (Orientation) -
Protein Name defect in organelle trafficking protein DotA
DNA Sequence
>gi|54292964:2981171-2984352 Legionella pneumophila str. Lens, complete genome
AGGCTCCTTTGAGCCCTTCTTATCGTATTTTTTAGAATGTTATTCAGGAGGTGGTGTACTGGTTGGGGGG
CCACTATCTGAGCCGCCCAGTTGTTGGCCTGTATCCGGTTTAGAGCTTGGTCCAGTCTGGCTGCCACTGT
TTTTACCTTTCCCTGAAACATCACCCGCATTTTCCGAAATCTTTTTAGCTTGAGGCCCCAATTTGCCAAG
CATCTCTTGCCCTTTAGCCCCCAATTTGTCACCAATAGCTTTCTCAGCCCCATAAGTAGCTTCGCCTGCT
TTCTCTACTCTACCTTTGGCTTCCTCACCCCATTGCATTGTTTCTTGACCAAAAGATTCCGGACTACCAC
CTATCCATCTCAGCACTTTATCTGGCAGGTGAGCAATCAGTGTAAAGGCTTTTTGTACAATAATTAAATA
CATACTGGTATAAATTAAGATGGAGAAGAAGAAAGCATACACTCCTGCCCAGCCTGTATACCCACCTTCT
AATGCAGTTGATTGATAATCACCTGTCAACTTATCCTTAAAATTATCCCATTGCGATGTATCCATCTTTG
CTCCAGTCCAGTTCCCGGCGCTCTGGAAAAACCTCTTCGCATCATTTGAACTGGTGCCTTTTTCCCATGT
TTCTATTCCTTGATCCGATTGGATGTAGGAAATGGCATGATCAAATCCGGCATTCAAAATCCACACGCCA
ACATAAGACAAGGCAATCGCTGCAATATATCCTATTATCATCAGAGAAGGTCTTAAAAAGACATTAACCA
AAATCATAATGGCAAATTCACCTTTACCAAAAGCCTCATTACCTTCTGGATGCGTAACACCCAAGGCAAC
AATAGGTGCAGCCACCATAGCCTCGATAACGGCTATCAGCCAGGCAAATGATCCAAAAGTAAAAATCATA
TAAGGTAAAACAGGTATATAATATGCTGTAACAAATCCTATGGACACCATGGTCCCTATCCATGCCATCA
ACAAAGGCATAGCCATCATAATCAAGGCAAAGATAAAGATACCAAAAAGTGGTATTAGTGAACTGACCAC
TGCCATATTCAACAGCGTTAGCCACAAAGTACCAGAAAAATTAATATACATCGTTCCCATATTAGCCAAT
GCGACAATGGGGTTTATTCCAGGCTGTGTCAGCGTTTGCACTCCCACTATGAAAATATCTTTCATGCCTT
GTAAAGGAATCATTAAAAAGGCCATGACGATGGAATTAATCATTTCTCCGAATATGGCTAAAAAGAAGTT
ATACACATACCTGAAAACATAGTTATAAAATAAGTCACCCATCATACGGCCAAGGCAAAACGAGAAGAAC
AAAATCTTCACCCTGCCGCAATCAAAATCCTGGTGCTTCATATAATAAAGCGACGTATCTACTTTAAAAT
TAATCAGATTGGCAAAGGTCAACGGTTTTATTCCTGGTTGACCTGGCAATTGAACCATCATGGAATTGTT
GACAAATCCATAGACTGTTGAGGACAATGGCCCACTCACAGACTGTCGTTGAGGATTATCACTAAGATCA
GGTTGCTTGACGCCATCCTGACCTAAAGCAGGTACGCCATCGATTAGTGACTGGATTTGAATCAGCTTAT
CACTCTTGTTTTGAAACCAGGTACACAATAATGAATAGGGATCCTGACACGTTTTTCCAAAGGGTTTGGT
AAGCTGTGTGGGATCAAAACTACTCTTATCTAGGCCTGTTCCCGTATCAAATTGGTCTGCAAACTCAGTT
GCGCTTCCATTGAGTTTCACCAAATCAAAAAAGTAAGAGCCAGCCATGATCCATCCTTTGGCATTGGCTT
CTGCAATAAAATCACGGGATTTCTTATCAAATTCTTCAGACGTAGCTTGTCTTATCAGATTGAGAGTTGG
CATCATAATGCCATTATAATCATTAATTGCACCTAAAAATTCGGTGCCATTAAACAATACTCCTGTAGTA
GATCCGGTGGAACTGGGTACCGACCCCCATGTTTTGCAAACTTGTTGATACTCAGTGCAAACCTCACCGG
ATGACTTATAAGGAACTCCAAACTGCTGTTTGGCAATAGCGGAAAAATCATTTTTTGAGTTTCCGGTAGA
CGTGGTTGTTGAAAACGCCGGATCATTATTAACCATGACCTGTGCCACAGTAGACAAAGTCACATACATT
TGCTGTATGGCAATCGCGCGAGACAATCGGGCTGTTTGCAATTGAGAAGAAGTTATATTTAAGCTGTTAG
CGCCCATGGATGAATTGGATCCAGCCCCTCCTACTGTCACAAGCCCTTTATTATCACTTTGATCCGTTGA
GTTCAAAGCGGAAATATTATTCCATTTGACTGTGCCGCAAATCCCGTTTAAGAAATAAAATGGTGAACTT
TTATCGAAATTTGGCATGTCCAGTTCAAAAGAAGGGGGCTGGTCTGCCGTTAGATCTTTAGGCGTATCAT
CATTTTGTTTCTTGACAAAATTTACCGTACTGATGAAATCAGGAATCGCTGTGCGGCAAAAAGTATTCAT
TTCAGGAGTAGGATTACCCCCACAAGGTGGACTCTTACTTTGACTCAAATAAAGATCTCTTTGTGCTTGT
AATTGTTTTTGTAAACCCAACATGCAGATTTGGCCACCCAATATAGTTAACGCTCCCTTTGCAACACCGG
AAGACGAAGATCCGGCTGCTTGCAAGCTCTTGGTTGGATCGGCCTGAGCCTGTATTATCACGCCACCCCG
GTTGAGATAACTCAAGGCGGCTTCCCATATTTTATCGGCTGCACCAACACCTTGCACAATAACCCACATA
AAAAATACCTGCATCATACAATAACCAGATGCTTTAGGTATTAACAAAGCCAAACCGAAGGTGGAACGAA
GAGGAATCCAGATTGAGGACCATTTTTGGCCTAGCATTTGCCCTTCATGGGCTGTGTTCATGGTGGAAAC
CATGAGGGTATACATAATGATGATTCCACCCAAAGCAAGGACAGCGGAGTTGAAGACACCAAACATATTG
CCCATTATCTGGCTTCCCGTTCCGTGCAGTACCCCATCGACTACACCAAACAGGTTACCTAAAAAAACGA
CGGACAAATCGCTTGCTGGAGGAGCGAAACTTAAGGAGCCACTTTCAGCGAGAGCAAGCGCAGGAAAAAA
GCAAAGGAGGACCGTAATAGCTAATTTATTCA
Protein Sequence
>gi|54295526|ref|YP_127941.1| defect in organelle trafficking protein DotA [Legionella pneumophila str. Lens] MNKLAITVLLCFFPALALAESGSLSFAPPASDLSVVFLGNLFGVVDGVLHGTGSQIMGNMFGVFNSAVLALGGIIIMYTLMVSTMNTAHEGQMLGQKWSSIWIPLRSTFGLALLIPKASGYCMMQVFFMWVIVQGVGAADKIWEAALSYLNRGGVIIQAQADPTKSLQAAGSSSSGVAKGALTILGGQICMLGLQKQLQAQRDLYLSQSKSPPCGGNPTPEMNTFCRTAIPDFISTVNFVKKQNDDTPKDLTADQPPSFELDMPNFDKSSPFYFLNGICGTVKWNNISALNSTDQSDNKGLVTVGGAGSNSSMGANSLNITSSQLQTARLSRAIAIQQMYVTLSTVAQVMVNNDPAFSTTTSTGNSKNDFSAIAKQQFGVPYKSSGEVCTEYQQVCKTWGSVPSSTGSTTGVLFNGTEFLGAINDYNGIMMPTLNLIRQATSEEFDKKSRDFIAEANAKGWIMAGSYFFDLVKLNGSATEFADQFDTGTGLDKSSFDPTQLTKPFGKTCQDPYSLLCTWFQNKSDKLIQIQSLIDGVPALGQDGVKQPDLSDNPQRQSVSGPLSSTVYGFVNNSMMVQLPGQPGIKPLTFANLINFKVDTSLYYMKHQDFDCGRVKILFFSFCLGRMMGDLFYNYVFRYVYNFFLAIFGEMINSIVMAFLMIPLQGMKDIFIVGVQTLTQPGINPIVALANMGTMYINFSGTLWLTLLNMAVVSSLIPLFGIFIFALIMMAMPLLMAWIGTMVSIGFVTAYYIPVLPYMIFTFGSFAWLIAVIEAMVAAPIVALGVTHPEGNEAFGKGEFAIMILVNVFLRPSLMIIGYIAAIALSYVGVWILNAGFDHAISYIQSDQGIETWEKGTSSNDAKRFFQSAGNWTGAKMDTSQWDNFKDKLTGDYQSTALEGGYTGWAGVYAFFFSILIYTSMYLIIVQKAFTLIAHLPDKVLRWIGGSPESFGQETMQWGEEAKGRVEKAGEATYGAEKAIGDKLGAKGQEMLGKLGPQAKKISENAGDVSGKGKNSGSQTGPSSKPDTGQQLGGSDSGPPTSTPPPE
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: dotA mutant is unable to replicate in mouse macrophages (Vincent et al., 2006).
References
Vincent et al., 2006: Vincent CD, Buscher BA, Friedman JR, Williams LA, Bardill P, Vogel JP. Identification of non-dot/icm suppressors of the Legionella pneumophila DeltadotL lethality phenotype. Journal of bacteriology. 2006; 188(23); 8231-8243. [PubMed: 16997951].