Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

flaA from Legionella pneumophila str. Lens

Victor ID 1459
Gene Name flaA from Legionella pneumophila str. Lens
Sequence Strain (Species/Organism) Legionella pneumophila str. Lens
NCBI Gene ID 3114487
NCBI Protein GI 54294228
Locus Tag lpl1293
Protein Accession YP_126643.1
Other Database IDs UniProtKB-ID: Q5WX06_LEGPL
UniRef100: UniRef100_Q5WX06
UniRef90: UniRef90_A5IBI3
UniRef50: UniRef50_P53606
UniParc: UPI00004457B2
EMBL: CR628337
EMBL-CDS: CAH15533.1
RefSeq_NT: NC_006369.1
GenomeReviews: CR628337_GR
KEGG: lpf:lpl1293
NMPDR: fig|297245.3.peg.2541
LegioList: lpl1293
eggNOG: COG1344
HOGENOM: HBG758847
OMA: TDARDII
ProtClustDB: PRK12806
BioCyc: LPNE297245:LPL1293-MONOMER
Taxonomy ID 297245
Gene Starting Position 1444065
Gene Ending Position 1445530
Gene Strand (Orientation) -
Protein Name flagellin
DNA Sequence
>gi|54292964:1444065-1445530 Legionella pneumophila str. Lens, complete genome
ATCGAAGTGCAGTTGTTGCTGCACTTCGATTGCGACATCCTATCGACCTAACAACGATAATACAGATTGT
GGTAGGCTATTAGCTTGTGCCAACATCGCTGTACCTGCTTGTTGCAGAATTTGGTTTTTGGTCAAACTAG
CCATTTCAGCAGCGTAATCAGCATCTTGAATACGACTTCTAGCAGCTGATAAGTTGTCTGATACGTTTTG
CAGGTTGGCTATCGTTGATTCAAAGCGATTTTGCAGAGCACCCATATTAGCCCGATTAGAGTTTACGCTA
TTGAGAGCTGCATCAATTCTCTTAATCGCTGTTTGAGCGCCAGACGCTGTGCTCACATCCAGTGAATCTA
TCCCTACTGTGTCTTTAGAGATATTGGCACTTAAACCAATGTTAGCAACAGTACCACCAATCGTGATAGT
ATCAACGGCGCTGATCGATAAAGTACCGCGTAACGCGCCATCAAATGCGCCACCAGTCACAGTTAAACCG
TCAGTACCCGCAGTAAAACCTGTACCGCTTTCTGTTACCGTAATGTTTCTGCCATCAGCAGCAGTGAGTG
TCATGTTACCACCGTTAAGTGACGCTACAACTCCAGTTTGGTTACTGACACCATTGATAGCATCCCGAAG
ATCGGAGTTGGTTAATGCCGTTGCTACATCGAGGTTAGTATATATTGCAACACCATTAATCGTTAAGTTG
TAGGTATCACCTGCGGTTCCACCTATTGCCCCAACTGCTTGTGTGCCGCTTGTAGAGGCCGTAACCGATA
GCCCTCCTATCCCGGCATCGTTGATAGCCGCTGCTTTGGCATAGGCAGACGTAGCATCTTGTCCGTTTAG
TGCCCCGGTGAAATTGGCAGAAGAGTTAATACTGGTTGCTGCTCCTCCTCCAATTGCGATAGTAATATCT
GTCGCTGCTGCACCAGCTACTTCTGTTCCTGTTGCCGTGGCAATACCACCAATAGAAGAAGCTTTTATGC
TACCGATACTGAAATTGATGGTTTGGTTTGAATTCGCCCCAACCTGGAAGCTTGCGCCAGAGAAAGAACC
ATCGAGAATTCTTTGACCATTGAATTCAGTATTTTGAGCAATACGCTCCAATTCACTTTTTAATTGTGAA
ATTTCGCTTTGAATTGAGGCGCGATCAGATGAGTTATTGGTCGAGTTGGCAGCTTGAACGGAAAGCTCAC
GCATACGTTGCAAAATATTGGTTGTTTCCTGCATTGCTCCTTCAGCAACCTGTGATAGGGATATACCATC
GTTAGCATTTCTAACGGCTTGATTCATCCCGCGAATTTGTGCAGTCATTCGTTGAGAAATGGCGAGTCCT
GCTGCATCATCTTTGGCACTGTTAATTCTTAATCCTGATGATAAACGCTGGATTGATGTCTGCATCATGT
TGCCCGAAACACCCAAATTGCGTTGGGCTGTAAGCGAAGCCACATTAGTGTTGATTACTTGAGCCA
Protein Sequence
>gi|54294228|ref|YP_126643.1| flagellin [Legionella pneumophila str. Lens] MAQVINTNVASLTAQRNLGVSGNMMQTSIQRLSSGLRINSAKDDAAGLAISQRMTAQIRGMNQAVRNANDGISLSQVAEGAMQETTNILQRMRELSVQAANSTNNSSDRASIQSEISQLKSELERIAQNTEFNGQRILDGSFSGASFQVGANSNQTINFSIGSIKASSIGGIATATGTEVAGAAATDITIAIGGGAATSINSSANFTGALNGQDATSAYAKAAAINDAGIGGLSVTASTSGTQAVGAIGGTAGDTYNLTINGVAIYTNLDVATALTNSDLRDAINGVSNQTGVVASLNGGNMTLTAADGRNITVTESGTGFTAGTDGLTVTGGAFDGALRGTLSISAVDTITIGGTVANIGLSANISKDTVGIDSLDVSTASGAQTAIKRIDAALNSVNSNRANMGALQNRFESTIANLQNVSDNLSAARSRIQDADYAAEMASLTKNQILQQAGTAMLAQANSLPQSVLSLLGR
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: flaA mutant is less invasive of HL-60 cells than the wild type (Dietrich et al., 2001).
COG COG1344N, under N: Cell motility
References
Dietrich et al., 2001: Dietrich C, Heuner K, Brand BC, Hacker J, Steinert M. Flagellum of Legionella pneumophila positively affects the early phase of infection of eukaryotic host cells. Infection and immunity. 2001; 69(4); 2116-2122. [PubMed: 11254565].