Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

sdhA from Legionella pneumophila str. Lens

Victor ID 1461
Gene Name sdhA from Legionella pneumophila str. Lens
Sequence Strain (Species/Organism) Legionella pneumophila str. Lens
NCBI Gene ID 3114696
NCBI Protein GI 54293370
Locus Tag lpl0419
Protein Accession YP_125785.1
Other Database IDs UniProtKB-ID: Q5WZG3_LEGPL
UniRef100: UniRef100_Q5WZG3
UniRef90: UniRef90_Q5ZYJ6
UniRef50: UniRef50_Q5WZG3
UniParc: UPI00004454E9
EMBL: CR628337
EMBL-CDS: CAH14649.1
RefSeq_NT: NC_006369.1
GenomeReviews: CR628337_GR
KEGG: lpf:lpl0419
NMPDR: fig|297245.3.peg.548
LegioList: lpl0419
HOGENOM: HBG520111
OMA: ANTAREK
ProtClustDB: CLSK832140
BioCyc: LPNE297245:LPL0419-MONOMER
Taxonomy ID 297245
Gene Starting Position 463770
Gene Ending Position 468059
Gene Strand (Orientation) -
Protein Name SdhA, substrate of the Dot/Icm system
DNA Sequence
>gi|54292964:463770-468059 Legionella pneumophila str. Lens, complete genome
TTTATGCTGATGGCGCTAATTGGTTTAACTCAATTGTTCCATTATTTTCAACAGAAGAAACTGGGGTAAT
TGCCCTGGATTCAGTAGAGATAGCTGACTCATTGCCAGCAAATAATCCAAATCGTTTGGTCAATTCATTG
ATTTTAGGCTGGGTTTTTACAGAGCTTTCCAAATTATTAAATAGTTTTCTTCTCTCCGGAGTGTACAGGC
AAAGCGCTTCCAATAAGGATAAGATGCATTGTTTTAAATAGGTAAAGCTAAAATAGCTTTCCTGTTTGTA
ATCCATGATGATTCTTTCAAAATTAGGATTTTTAACATGGAAAGATATTTGGTCTACACGCTCTTTTGGC
GTAAGGGTTCCATCTTCACTGATATCAACCAGTTTATTAATGAGCTCTGTCTTTTTCGCCAGTGTCTCTT
CGCTTTCAAATGTCGAATTATTTTGCTCGATGGCAGCGGTAGAAAGACTAAAGTAGTTTTTAAATTGAGC
TAAAGCGACTCTTACTGCATCAAGATGATAATATTTCTCAAAATTATCTCTTTCAAAATTTTTAATTTTT
TCCTTTAGCAAATTTTTTATAGTTAAATTAATATCTTCTGCGGATTTTGAGCGTTGAATAATACTTTCTT
TAAAAGTCAGTAAATATTCTCTAAGTTTTGTGCGATATTCCTTGTCAGTGTATTGTAAACCTATATGGCG
GTTGCAGAAAGCATCTAATTGTTTATTAAATGATTCTGTAGTGTATTCTTCTATATAAAGGAGATCTTCT
TGTTCCTGAGTCGATCGTAACTCTTTAAGATAGCTCAACTTTTCTCTGGCAGTATTTGCTTTCATAAGAT
AAGTGGCTTTTAAGCCTTCATAATGATGGTAGCTTGCGATAATGAGAGGCTTTATGAGCGTTAATTTAGG
TTCATACTCTTTCAGTTCTGAATTTAAAAGAGTGTCTAATTCATAATCTTCAGGATCAGGATCTGTATTC
TCTGGTAATCGCTTCTGTAGTTTTACCAATTTGTACAGAGCTTTTTTATAAGTTTCGATTAATTCATCAT
CAGTGGTTTTGCCGCCTTTTGTTTTAATAATTTCATATAACTTAATGATATGTTTATAGTTTTTTTCTAT
TTTATCCAAATGTTGTGTTGCATTTTCGAGTTTTTTATGTGTTGTTTTTATTCTTTGATCTATTGGTGAT
TTATCACATATCATTCGAATATGGGCTTTGGAATGCAGCGCTAAAGGATGTAACAGGCCTTTATAATATT
CATCCGTTATTGTTTTTAATGGTCCTGAGATAGTGCCTGGTACCAATCCTAATTTATCTTCCCATGCGTC
CGCTTCCATCAGCATGGGGGTGAAAATCTTGGAGCGGAATTGATCCAGATTATTCATTACTGCGTCATGT
GATGTGCTAATAAATTCATTCAGTTTATTAGTCATTTCTCTATAGAGAGAATACATGGCAGGCGTTTGTA
AGAATAATTTGAAATAGGAGTTTGAACTCTTAATAATATTTTCTACAGTAACAGTTGCTTTCTTTGCCTT
TAAGTGTAAGTCGTTGAGTTCTTCTGTCGTGAGATAGTTGGTATTTCTTAAGCTTCTAATGTGTTTTGGT
GAAATATAAAAAGCATTGAGTGTGTACCAAAGGGCATTGTACTTAATATCATGGTTATAAGGTACTTCTA
AGGGGGATACCTGATAGGCATCACTGTGTTCTTGTATTGTTGCAATAAGCGTTTGCGCTTTTTCCAGTAA
CTCGCTTGCTATGAGCTTAAAATGAGGATCCACAGCAAGTTTTAGCGCTAGCTTCTTAATTTCATTAATG
TGATCATAGGCTTGTATTAAATGATAAACATAGATGCTTTCGTAACTTCTGGTATCCAGCTTTTCCAGTT
CAACAACAATTTTTTCAACATGATAAAGGCTGTTGAATATGCGTTTTATTGCGATAACCTGTGCGCTCTG
GGCAAGCTCTTTATTTTTATCTTGCAATTCAGGGTAAGGAATTCCGTTGGGTTGCTGCTTAAGTTGGGCT
TTCATTGCATTATTAAATAATGAAATGACTTGATTAAGCTCCGTTCTGAACTCATATATGCATTTAGAGA
AATTGGTATGTTTAATTAAATGATGGGCTCTGCTTTCCAGTTTTTCATCATGTTCAAGTTCGGTTGAGTT
ATTTTCACTGGCAAATTTTTCCTGGGCCCATTTTAAATATTGATTACTCTTTTTACTCCATTGTAAATCA
ATTTCTGTAAAATAAATTTGAAAATGTTCATCCAGTTTTTCAAACAGGTCAACTGCCGGAGCATCATAGG
TGGATGACTCATTAGAAAAGGAATGGACCAAAAATTTGTCAAAACTTATTGCGGAAGCTCTGAGTTCAGG
AGGTATCCCATCGATAAAATAAGGTTGAAATATATTATATAAATTACGGCAGCGAGTTTTGGTCTCTTTA
TCAAGATTATTTAAATGGAGAATCCTGCCTTCCGTTTCAGCGATTGTCTTGGTTTGCTTTTTTAATAAGG
TAATAAATTCGTTATATGCTTTGCTGGCAACTCTGAATTTTTCACGTTTGTTTCTATACCATTGATAGAG
GTCAAGAGCCTGTTCAGATGTTAAATCCTCAGGATTAACCAGTATATTATGTCCTTTCTCTGGTCTGAAT
TTTAGTTTGTCCGTAGCGCCATTAGCAGGGTTTAGTGCTTTTGTCTCATCCAGAAGAAAGACATTCGTTT
TTTCATTATAAGGGAATAAAACCAGATTTGTTTGTTTGTGAACAGATTCGATAAGGTCTCTATTCAATTC
GATATGAAATTGTTGAGTGGCTTTCTTTTTGCTAATTAAAGTTTGTAATGCTTCCTTTTGCGCTAAAACA
AAACTGGCGTGATCGGCAGGAAGAGTGCCTCTTAACCAACGCCACGGCTTCTTTACATAAGAAGACCAGG
ATTCCGGGCCTTGAAAACTATCGATCAACAAAATATTGAGATCAGGATCCACATCCATCATATAAGGACT
GATTATTTTGTAATATGTAATCAGTTGATTTTTAATTTCTTTCGGTAATTGATGTATGGGTTGCTTATTA
TAGGGGGGGGTGTCCAGTATTTTGTAAAAATTGTCCAGAGCTTCTTGCGCTTTTTGAATTTTAAAAAGGG
CTTTATTAGCTTCATCAATTCGTTGATATGTTCTTTCCAGTCTTAAAGCGAGAAAACGGGAGTCCTCTAT
ACTGAGTAACTCTTCTCCTTTTTCTTTGAAATTGACGGGTTTTGATGCGTAATAAATTAAAAGTTGGTAT
AGAGGTTTGATTTTTTCCATTAACGGAATAGACAGTGTACCAGGCTTCAGCATGGCATTGTCTTCAATTT
TATCCACTAACCCAAATAACGTAGGTAATACAACGTATTTTAATTGAGCCAAATTATCACGAATGACGTC
TTGGGATGAATCACTGAAATGTCCCATTTGCTCAACAGAGCTTGTCGCCAATGTGATGATATTACGGATA
ATGTGAATGTATTTTAAAACTTTAAGGGATATAAAAAAGTCATTCCCTTTCAGATGTTCAAGGTCATTTA
GTAATTTTAATGATGCGTTTTGTAACTCTTCCAGCTTTTCATTATTTAGGGTAGGCTCTTTTTCTTTGAT
TTGCGAAGAGTATTGTTGAATGTATTGAGTTAATTTTTCTATATAACCAGGTAATACGGCACTGAATTGA
GTGAGGAATTGGTAATCCCAATCTCCTGTTCTCGGTTGCATTTGCTCTAAGGCAATGCCTGTAACTTCTC
CTGCTTTATAGCTTATAGGAAAATCCTTCCAAGACTCTGCCAAACGCTTGGTGCATTCCTGGTGTTCACC
AGCAAAGGCTTGTAGTTGTCCAATGACAGGGAGAATAAGATCAATCTCTTCCTTGAACATTTCCTGCAAA
TCAACATCGAGGTTAGTGATTAGATAACCGGCTTGATAGGCCTGGTGAATCGTATTGCTATAAAGTAATT
TGAGGTCAGGGAGTGTTCGTTTGTAGTTGCGTATATCAATATTCTCTAAATCCAGAAAAGCTAAACGGGC
ATGGTAAAGGGCGTTAATAAGTTTTTTGATTTGAGAAATATTTTCCGGGTCAAGATCAAAATCGGTGAAT
GGAACCCCGTCTTTATTCATTTTTTCCAAGTAGGGGGCTAGTCTGGGGTTGAAATGTCCACTTTTTAAAG
TCACAAGGATTTTTGAATTAATTTTTTCAATTAATTTAGAGAATTGGTTTTGCTTAAAGGATTCTAAAAG
CTTGATCTTTTCTGAAATCA
Protein Sequence
>gi|54293370|ref|YP_125785.1| SdhA, substrate of the Dot/Icm system [Legionella pneumophila str. Lens] MISEKIKLLESFKQNQFSKLIEKINSKILVTLKSGHFNPRLAPYLEKMNKDGVPFTDFDLDPENISQIKKLINALYHARLAFLDLENIDIRNYKRTLPDLKLLYSNTIHQAYQAGYLITNLDVDLQEMFKEEIDLILPVIGQLQAFAGEHQECTKRLAESWKDFPISYKAGEVTGIALEQMQPRTGDWDYQFLTQFSAVLPGYIEKLTQYIQQYSSQIKEKEPTLNNEKLEELQNASLKLLNDLEHLKGNDFFISLKVLKYIHIIRNIITLATSSVEQMGHFSDSSQDVIRDNLAQLKYVVLPTLFGLVDKIEDNAMLKPGTLSIPLMEKIKPLYQLLIYYASKPVNFKEKGEELLSIEDSRFLALRLERTYQRIDEANKALFKIQKAQEALDNFYKILDTPPYNKQPIHQLPKEIKNQLITYYKIISPYMMDVDPDLNILLIDSFQGPESWSSYVKKPWRWLRGTLPADHASFVLAQKEALQTLISKKKATQQFHIELNRDLIESVHKQTNLVLFPYNEKTNVFLLDETKALNPANGATDKLKFRPEKGHNILVNPEDLTSEQALDLYQWYRNKREKFRVASKAYNEFITLLKKQTKTIAETEGRILHLNNLDKETKTRCRNLYNIFQPYFIDGIPPELRASAISFDKFLVHSFSNESSTYDAPAVDLFEKLDEHFQIYFTEIDLQWSKKSNQYLKWAQEKFASENNSTELEHDEKLESRAHHLIKHTNFSKCIYEFRTELNQVISLFNNAMKAQLKQQPNGIPYPELQDKNKELAQSAQVIAIKRIFNSLYHVEKIVVELEKLDTRSYESIYVYHLIQAYDHINEIKKLALKLAVDPHFKLIASELLEKAQTLIATIQEHSDAYQVSPLEVPYNHDIKYNALWYTLNAFYISPKHIRSLRNTNYLTTEELNDLHLKAKKATVTVENIIKSSNSYFKLFLQTPAMYSLYREMTNKLNEFISTSHDAVMNNLDQFRSKIFTPMLMEADAWEDKLGLVPGTISGPLKTITDEYYKGLLHPLALHSKAHIRMICDKSPIDQRIKTTHKKLENATQHLDKIEKNYKHIIKLYEIIKTKGGKTTDDELIETYKKALYKLVKLQKRLPENTDPDPEDYELDTLLNSELKEYEPKLTLIKPLIIASYHHYEGLKATYLMKANTAREKLSYLKELRSTQEQEDLLYIEEYTTESFNKQLDAFCNRHIGLQYTDKEYRTKLREYLLTFKESIIQRSKSAEDINLTIKNLLKEKIKNFERDNFEKYYHLDAVRVALAQFKNYFSLSTAAIEQNNSTFESEETLAKKTELINKLVDISEDGTLTPKERVDQISFHVKNPNFERIIMDYKQESYFSFTYLKQCILSLLEALCLYTPERRKLFNNLESSVKTQPKINELTKRFGLFAGNESAISTESRAITPVSSVENNGTIELNQLAPSA
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: sdhA mutant is attenuated in mouse macrophages (Laguna et al., 2006).
References
Laguna et al., 2006: Laguna RK, Creasey EA, Li Z, Valtz N, Isberg RR. A Legionella pneumophila-translocated substrate that is required for growth within macrophages and protection from host cell death. Proceedings of the National Academy of Sciences of the United States of America. 2006; 103(49); 18745-18750. [PubMed: 17124169].