Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

lvgA from Legionella pneumophila str. Lens

Victor ID 1465
Gene Name lvgA from Legionella pneumophila str. Lens
Sequence Strain (Species/Organism) Legionella pneumophila str. Lens
NCBI Gene ID 3115099
NCBI Protein GI 54293520
Locus Tag lpl0571
Protein Accession YP_125935.1
Other Database IDs UniProtKB-ID: Q5WZ13_LEGPL
UniRef100: UniRef100_Q5WZ13
UniRef90: UniRef90_Q9RNG8
UniRef50: UniRef50_C6N5R8
UniParc: UPI000044555B
EMBL: CR628337
EMBL-CDS: CAH14802.1
RefSeq_NT: NC_006369.1
GenomeReviews: CR628337_GR
KEGG: lpf:lpl0571
NMPDR: fig|297245.3.peg.822
LegioList: lpl0571
HOGENOM: HBG520054
OMA: AFESIIN
ProtClustDB: CLSK832234
BioCyc: LPNE297245:LPL0571-MONOMER
Taxonomy ID 297245
Gene Starting Position 617991
Gene Ending Position 618617
Gene Strand (Orientation) +
Protein Name hypothetical protein
DNA Sequence
>gi|54292964:617991-618617 Legionella pneumophila str. Lens, complete genome
AATGGCAGACGGCGATATCGAAATCAAGGCAGGTTTCGTAGATACTGATCTAGACGATCGCAAACTGACA
ATGATAGATGATTTGAATAATCCATTAGCCATAGTGGAGCGAGTCTATCTGATATGGTGGCATTGGGCAG
ATTTTCATCTTCATGTTATTTCTCCGCATATTGATACTATTACTCCTGCGATAGTCATCGAACCCGAGCT
GATACCTGGTTCTAATGATCATGAATTTGTTTATTCCATTCATGATAGTGGCTCTAAATTATCTACATCC
AAAAGCCAGGATATGTTTAGTGCGGGTATGTCCATGTGCAAACTTTTCTATACTATTGAAAAAATGGTTC
ATATTCTGGTAGATCGCTTAAAATCTGGTGGAGTAAGTATGGAAGCAGAAGTTCAGATAGCTTTTGCTGG
CCATGAAATAGCACAGAGAAAGGCTTTTGAGTCCATTATTAATTTACCTTATAACGTTGTTGTGACTAAT
TTTGATCCTGGAATATGGGGTGAAAAATATTTACAAAATGTGAAGCGCTTGGCGGATAAGGGGTATGGTT
ATCCTCCTGAATCCCCAAGAGAAAATTATAAGCATCCGGTATCTTCTGCAACTACTGCACGAAAATA
Protein Sequence
>gi|54293520|ref|YP_125935.1| hypothetical protein lpl0571 [Legionella pneumophila str. Lens] MADGDIEIKAGFVDTDLDDRKLTMIDDLNNPLAIVERVYLIWWHWADFHLHVISPHIDTITPAIVIEPELIPGSNDHEFVYSIHDSGSKLSTSKSQDMFSAGMSMCKLFYTIEKMVHILVDRLKSGGVSMEAEVQIAFAGHEIAQRKAFESIINLPYNVVVTNFDPGIWGEKYLQNVKRLADKGYGYPPESPRENYKHPVSSATTARK
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: lvgA mutant is attenuated in guinea pigs (Edelstein et al., 2003).
References
Edelstein et al., 2003: Edelstein PH, Hu B, Higa F, Edelstein MA. lvgA, a novel Legionella pneumophila virulence factor. Infection and immunity. 2003; 71(5); 2394-2403. [PubMed: 12704109].