Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

feoB from Legionella pneumophila str. Lens

Victor ID 1467
Gene Name feoB from Legionella pneumophila str. Lens
Sequence Strain (Species/Organism) Legionella pneumophila str. Lens
NCBI Gene ID 3115599
NCBI Protein GI 54295497
Locus Tag lpl2584
Protein Accession YP_127912.1
Other Database IDs UniProtKB-ID: FEOB_LEGPL
UniRef100: UniRef100_Q5WTE1
UniRef90: UniRef90_Q5X1N2
UniRef50: UniRef50_Q5WTE1
UniParc: UPI0000445C22
EMBL: CR628337
EMBL-CDS: CAH16825.1
RefSeq_NT: NC_006369.1
GenomeReviews: CR628337_GR
KEGG: lpf:lpl2584
NMPDR: fig|297245.3.peg.1358
LegioList: lpl2584
eggNOG: COG0370
HOGENOM: HBG731320
OMA: AMMYLMF
ProtClustDB: CLSK833536
BioCyc: LPNE297245:LPL2584-MONOMER
Taxonomy ID 297245
Gene Starting Position 2950999
Gene Ending Position 2953254
Gene Strand (Orientation) -
Protein Name ferrous iron transporter B
DNA Sequence
>gi|54292964:2950999-2953254 Legionella pneumophila str. Lens, complete genome
ATCACGTATTTGCAGCAGCATTTTGCCTCCCCATACCATACTGGCTATAACGAAATACAGCTAAAACAAA
AAGCAGACTCAGTGACATAGCCAAAATCCAGATCATACTTTGTTGAGGATGCTCCAGAAATTTAGCGCCT
TGATAAAAAACAACAGAAGTAGCGTAAGCCACGACAAATGACCAAACAATGGAAGTCCACATAAATCGCT
TGTTTGCCTCCTGGCGAATCACCGCCATAGTCGAAACACAAGGGATATAAAGCAAAACAAAAAGCAAATA
AGCGTAGGCTCCTACAGCTCCATCAAAACGTCGTGACATAATGCCATAGACAGATTGAGATAACTCACTA
TCAGCTGCACTGGCAGAAACAGGGTTCCACAATGCAGAGCCTAATTCAGACAAATTGGCGGGAATAGACC
CAAAAGCAGCTTTGATGCCCCCCAAAAAATCAAAGTGAGCAGCAGTTATTTCTCCCACATGGCCTACTTG
GGCATAAAGTGAGTTTAAGGTGCCAACCACTACCTCTTTAGCCAGCATGCCAGTTAATAAACCGACAGTC
GCGGGCCAGTTGTCTTGATGAATTCCCATTGGAGCAAATAATGGAGTAATCCACTGACCTATTATTGACA
ATAAAGAATCCGTATTGGCTTCTCCGGAGCTAATCCCTCCTCCCCAAGTAATCGCATTTAATCCTCCCAG
AATCACACAAATGGGAATAATCAGCTTACCCGCACGATAAACAAAAAATCGTAATCGCAAGGAGGTTTCT
CTCAGCAATCTTCTGAGTGAAGGCCTATGATAAGCGGGTAACTCCAAAATCAAAGGAGAAGCATGTCCTT
TCAACGTAGTTTTGCGTAAAATATATCCGGTAAATACGGCCATTAAAATGCCAATCAAATACAAGGAAAA
AACAACATTATGCCCGCCAGAGGGGAAAAAGGCCGCGACAAATACCGCATAAATAGCCAATCGGGCACTA
CAAGACATAAATGGACTCATCATCACAGTTAATAATCGATCGCGCTCCGAGTCCAGGGTGCGTGCTGCCA
TAATGGCAGGGACATTACATCCAAAACCCACAATCATGGGTACAAATGATTTTCCTGGTAATCCCATGGC
TCGCATCGCTTTATCCACGACAAAAGCAGCTCTTGCCATATAACCAGAAGTTTCCAACAAGGACAAAAAG
AAAAACATCGCGGCAATCACAGGAATAAAAGTAATAGTGGTATTAATTCCTTTGCCTATCCCATTAGCTA
CAAGCGCGATTACCCAATTTGGTGCATGGAGCTGTTGCAACAACCAACCACTACCCTGAACAAAGATAGT
CTCTGTACTAATGTCAAAAAAATCCTGGAATGCTCCCCCAATATTAATAGCAAACAAAAACATCAAATAC
ATCATCGCAAAAAATATGGGTAAAGCTAAAAAGCGATGCAAAACAAGTTTATCCAATTTAGCAGTGAAGT
GTTCGCTGGCATCACTATGCTTTTTTTGAACCAACGTCACAATTTCATGAATTTTTTGATAGCGAGCGTC
TGCCAGTAACACATCAAGATTTTGCTCCGTTTTTTGAAGCTTTATAAGAAGACTTTCGGTAAAAGCTTTC
TCTCCTATCAAAGTATCCCCTTCGGCAAGCCTACGGGAGAAATAGTAGGCAAAGGAATTTTTATACCCTT
TTGAGATCAGCTGATTTTCCAGGTCATTCAAAATTTGTTGTGCTGCAACCGATAAGGAAAGTTTTAAAGG
TTTTATCTTTTGGGAGCAATGAAGTAATGATTGCTGAAGTGCCGGAACACCAATGTTTTTATGGGCCTGA
ATGGGAATAACAGAACACCCCAACAAACTCTCGAGTTTCTCTGTATCTATAGAAATACCCCGATGCTCGG
CAATATCCATCATGTTAAGTGCTACAACAACAGGTTTACCTAACTCAAAAAGTTGGCTGGTTAAATACAA
ATGTCTTTCAAGGTGACAAGCATCTATAACATTAATGATGCAATCGTATTCCAAATCAATAACTGACTGA
GCAGCAATTTGCTCATCCTGGCTTATTCCTTCGGCATTCGCAACCAGAGAATAGACCCCTGGCAAATCAG
TGATTTCAATTAAATGTTCTCCAAGCAAAAATTCACCTGTTTTTTTCTCAACAGTTACTCCGGGCCAGTT
GCCTACGCGTTGATTCGCATTGGTCAAGGCATTGAATAGGGTTGTCTTACCACAATTGGGATTTCCTATT
AATAGGGCATGAGTCA
Protein Sequence
>gi|54295497|ref|YP_127912.1| ferrous iron transport protein B [Legionella pneumophila str. Lens] MTHALLIGNPNCGKTTLFNALTNANQRVGNWPGVTVEKKTGEFLLGEHLIEITDLPGVYSLVANAEGISQDEQIAAQSVIDLEYDCIINVIDACHLERHLYLTSQLFELGKPVVVALNMMDIAEHRGISIDTEKLESLLGCSVIPIQAHKNIGVPALQQSLLHCSQKIKPLKLSLSVAAQQILNDLENQLISKGYKNSFAYYFSRRLAEGDTLIGEKAFTESLLIKLQKTEQNLDVLLADARYQKIHEIVTLVQKKHSDASEHFTAKLDKLVLHRFLALPIFFAMMYLMFLFAINIGGAFQDFFDISTETIFVQGSGWLLQQLHAPNWVIALVANGIGKGINTTITFIPVIAAMFFFLSLLETSGYMARAAFVVDKAMRAMGLPGKSFVPMIVGFGCNVPAIMAARTLDSERDRLLTVMMSPFMSCSARLAIYAVFVAAFFPSGGHNVVFSLYLIGILMAVFTGYILRKTTLKGHASPLILELPAYHRPSLRRLLRETSLRLRFFVYRAGKLIIPICVILGGLNAITWGGGISSGEANTDSLLSIIGQWITPLFAPMGIHQDNWPATVGLLTGMLAKEVVVGTLNSLYAQVGHVGEITAAHFDFLGGIKAAFGSIPANLSELGSALWNPVSASAADSELSQSVYGIMSRRFDGAVGAYAYLLFVLLYIPCVSTMAVIRQEANKRFMWTSIVWSFVVAYATSVVFYQGAKFLEHPQQSMIWILAMSLSLLFVLAVFRYSQYGMGRQNAAANT
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: feoB mutant is attenuated in human macrophages (Robey and Cianciotto, 2002).
COG COG0370P, under P: Inorganic ion transport and metabolism
References
Robey and Cianciotto, 2002: Robey M, Cianciotto NP. Legionella pneumophila feoAB promotes ferrous iron uptake and intracellular infection. Infection and immunity. 2002; 70(10); 5659-5669. [PubMed: 12228295].