Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

plaB from Legionella pneumophila str. Paris

Victor ID 1468
Gene Name plaB from Legionella pneumophila str. Paris
Sequence Strain (Species/Organism) Legionella pneumophila str. Paris
NCBI Gene ID 3116520
NCBI Protein GI 54297520
Locus Tag lpp1568
Protein Accession YP_123889.1
Other Database IDs UniProtKB-ID: Q5X4V5_LEGPA
UniRef100: UniRef100_Q5X4V5
UniRef90: UniRef90_A5IC98
UniRef50: UniRef50_D3HQ45
UniParc: UPI0000444E2D
EMBL: CR628336
EMBL-CDS: CAH12719.1
RefSeq_NT: NC_006368.1
GenomeReviews: CR628336_GR
KEGG: lpp:lpp1568
LegioList: lpp1568
eggNOG: NOG14116
HOGENOM: HBG520456
OMA: PANHGSA
ProtClustDB: CLSK929571
BioCyc: LPNE297246:LPP1568-MONOMER
Taxonomy ID 297246
Gene Starting Position 1747959
Gene Ending Position 1749392
Gene Strand (Orientation) +
Protein Name phospholipase
DNA Sequence
>gi|54295983:1747959-1749392 Legionella pneumophila str. Paris, complete genome
AAGGAGCGTTATGATTGTTATCTTCGTCCATGGCTGGAGTGTCACGCATACCAATACTTATGGGGAACTT
CCTCAATGGCTTGAAAATCAGAGCAAACAGGGAAAGCTGGATATTCAAGTCGGCAATATTTATCTTGGGC
GCTACATCAGTTTTGATGATACGGTGACGGTTGACGATATAGCACGCGCATTTGATCAAGCGGTACGTGA
TGAAATTGCTGATAAGCTACGAGATGGGCAGCGTTTTGCTTGTATCACTCACTCTACCGGTGGGCCCATT
GTCCGCAAATGGATGGATTTATACTTTAAGAATAATCTTGCAAAATGTCCGTTAAGTCACCTTATCATGC
TGGCTCCTGCCAACCACGGTTCTGCTCTTGCTCAGCTTGGCAAATCCCGCCTAGGCCGCATAAAGAGTTT
TTTTGAAGGCATTGAACCGGGAAAGTGTGTACTTGATTGGCTTGAGCTCGGAAGCGATAAGAGCTGGCAA
CTTAATGAAAGCTGGCTTGATTATGATTGCACTGCCAATGGTGTCTATTCCTTTGTACTTACTGGCCAGA
AAATTGATCGCCAATTTTATGATGCAGTAAACTCCTACACAGGAGAATCTGGATCCGATGGGGTGGTACG
CGTTGCTGCAACAAATATGAATTATAGCTTATTGAAATTACATCAGGAGGGGGATAACGGTGAAAGTCTT
GTTGTCGCCAAAATGACACGAACACAGCCAATGGCATTTGGAGTTCTACCTGGACTTTCACATTCCGGTA
AAAATATCGGTATCATCCGTAGTATTACTATGGCCAATGCAGCCAATCACCCCACGGCGATATGGATCCT
GCGATGCCTGCAAGTAAAAAGTCGTGACTCCTATAATAAATTAGTAAAAGAGTTAGACAATATTACTAAA
GAGACTCAGAAAAATGAGCATAAGGAATTTGTGAAAACACTTGTCTTTACGCGCGAGTATATAACCAATC
GTTACTCTATGATTATTTTCCGGCTTATTGATGACCGCGGCAATCACCTTATCGATTATGATCTTTACCT
AACTGCCGGACCTCAATATAGCGAGCAGGCGCTTCCTGCAGGTTTTTTTGTAGATCGTCAGCGAAATCTC
AATAATCGAGGTAAACTGACTTATTTTCTTGACTACGATATTATGGAAGGTGGAATTAATACCCCAAAAA
TGCAGGGTAATCTTGGGTTTCGTGTTAAAGCATATCCTGAATCAAGTGACCAAGCCCTTGCCTATTACAG
GTTACTTGATTTTCATTCATCGCTTGCTGACATTCACAAAATACTTCATCCGAATGAAACCGTAATGGTT
GAAATCATGCTTCAAAGACGAGTAGATAGGACAGTTTTCCGTATCAGCAACAACCTTACTCCGGCAAAAA
TCAGTGGAAAGCCAACTGGCAAAAAGATAGATTG
Protein Sequence
>gi|54297520|ref|YP_123889.1| phospholipase [Legionella pneumophila str. Paris] MIVIFVHGWSVTHTNTYGELPQWLENQSKQGKLDIQVGNIYLGRYISFDDTVTVDDIARAFDQAVRDEIADKLRDGQRFACITHSTGGPIVRKWMDLYFKNNLAKCPLSHLIMLAPANHGSALAQLGKSRLGRIKSFFEGIEPGKCVLDWLELGSDKSWQLNESWLDYDCTANGVYSFVLTGQKIDRQFYDAVNSYTGESGSDGVVRVAATNMNYSLLKLHQEGDNGESLVVAKMTRTQPMAFGVLPGLSHSGKNIGIIRSITMANAANHPTAIWILRCLQVKSRDSYNKLVKELDNITKETQKNEHKEFVKTLVFTREYITNRYSMIIFRLIDDRGNHLIDYDLYLTAGPQYSEQALPAGFFVDRQRNLNNRGKLTYFLDYDIMEGGINTPKMQGNLGFRVKAYPESSDQALAYYRLLDFHSSLADIHKILHPNETVMVEIMLQRRVDRTVFRISNNLTPAKISGKPTGKKID
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: plaB mutant is attenuated in guinea pigs (Schunder et al., 2010).
References
Schunder et al., 2010: Schunder E, Adam P, Higa F, Remer KA, Lorenz U, Bender J, Schulz T, Flieger A, Steinert M, Heuner K. Phospholipase PlaB is a new virulence factor of Legionella pneumophila. International journal of medical microbiology : IJMM. 2010; 300(5); 313-323. [PubMed: 20153694].