Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

lvgA from Legionella pneumophila str. Paris

Victor ID 1470
Gene Name lvgA from Legionella pneumophila str. Paris
Sequence Strain (Species/Organism) Legionella pneumophila str. Paris
NCBI Gene ID 3116728
NCBI Protein GI 54296559
Locus Tag lpp0590
Protein Accession YP_122928.1
Other Database IDs UniProtKB-ID: Q5X7L5_LEGPA
UniRef100: UniRef100_Q5X7L5
UniRef90: UniRef90_Q9RNG8
UniRef50: UniRef50_C6N5R8
UniParc: UPI0000444B5B
EMBL: CR628336
EMBL-CDS: CAH11738.1
RefSeq_NT: NC_006368.1
GenomeReviews: CR628336_GR
KEGG: lpp:lpp0590
LegioList: lpp0590
HOGENOM: HBG520054
OMA: AFESIIN
ProtClustDB: CLSK832234
BioCyc: LPNE297246:LPP0590-MONOMER
Taxonomy ID 297246
Gene Starting Position 634497
Gene Ending Position 635123
Gene Strand (Orientation) +
Protein Name hypothetical protein
DNA Sequence
>gi|54295983:634497-635123 Legionella pneumophila str. Paris, complete genome
AATGGCAGACGGCGATATCGAAATCAAAGCAGGTTTCGTAGATACTGATCTAGACGATCGCAAACTGACA
ATGATAGATGATTTGAATAATCCATTAGCGATAGTGGAGCGAGTCTATCTAATATGGTGGCATTGGGCAG
ATTTTCATCTTCATGTTATTTCTCCGCATATTGATACTATTACTCCTGCGATAGTCATAGAACCCGAACT
GATACCTGGTTCTAATGATCATGAATTTGTTTATTCCATTCATGATAGTGGCTCTAAATTATCTACATCC
AAAAGCCAGGATATGTTTAGTGCAGGCATGTCTATGTGCAAACTTTTTTATACTATTGAAAAAATGGTTC
ATATTCTGGTAGATCGCTTAAAATCTGGCGGTGTCAGTTTGGAGGAAGAGGTTCAGATAGCTTTTGCTGG
CCATGAAATAGCCCAGAGAAAGGCTTTTGAGTCAATTATTAATTTACCTTATAATGTTGTTGTGACTAAT
TTTGATCCCGGAATATGGGGTGAAAAATATTTACAAAATGTGAAACGCCTGGCGGATAAAGGGTATGGTT
ATCCTCCTGAATCCCCAAGAGAAAATTATAAGCATCCGGTATCTTCTGCAACTACTGCACGAAAATA
Protein Sequence
>gi|54296559|ref|YP_122928.1| hypothetical protein lpp0590 [Legionella pneumophila str. Paris] MADGDIEIKAGFVDTDLDDRKLTMIDDLNNPLAIVERVYLIWWHWADFHLHVISPHIDTITPAIVIEPELIPGSNDHEFVYSIHDSGSKLSTSKSQDMFSAGMSMCKLFYTIEKMVHILVDRLKSGGVSLEEEVQIAFAGHEIAQRKAFESIINLPYNVVVTNFDPGIWGEKYLQNVKRLADKGYGYPPESPRENYKHPVSSATTARK
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: lvgA mutant is attenuated in guinea pigs (Edelstein et al., 2003).
References
Edelstein et al., 2003: Edelstein PH, Hu B, Higa F, Edelstein MA. lvgA, a novel Legionella pneumophila virulence factor. Infection and immunity. 2003; 71(5); 2394-2403. [PubMed: 12704109].