Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

sdhA from Legionella pneumophila str. Paris

Victor ID 1473
Gene Name sdhA from Legionella pneumophila str. Paris
Sequence Strain (Species/Organism) Legionella pneumophila str. Paris
NCBI Gene ID 3117748
NCBI Protein GI 54296413
Locus Tag lpp0443
Protein Accession YP_122782.1
Other Database IDs UniProtKB-ID: Q5X811_LEGPA
UniRef100: UniRef100_Q5X811
UniRef90: UniRef90_Q5ZYJ6
UniRef50: UniRef50_Q5WZG3
UniParc: UPI0000444AE9
EMBL: CR628336
EMBL-CDS: CAH11591.1
RefSeq_NT: NC_006368.1
GenomeReviews: CR628336_GR
KEGG: lpp:lpp0443
LegioList: lpp0443
HOGENOM: HBG520111
OMA: ANTAREK
ProtClustDB: CLSK832140
BioCyc: LPNE297246:LPP0443-MONOMER
Taxonomy ID 297246
Gene Starting Position 487868
Gene Ending Position 492139
Gene Strand (Orientation) -
Protein Name SdhA, substrate of the Dot/Icm system
DNA Sequence
>gi|54295983:487868-492139 Legionella pneumophila str. Paris, complete genome
ATTAGTTTAACTCAATTGTTCCATTATTTTCAATAGAAGAAACTGGGGTAATTGCCCTGGATTCAGTAGA
GATAGCTGACTCATTGCCAGCAAATAATCCAAATCGTTTGGTCAATTCATTGATTTTAGGCTGGGTTTTT
ACAGAGCTTTCCAAATTATTAAATAGTTTTCTTCTCTCCGGAGTGTACAGGCAAAGCGCTTCCAATAAGG
ATAAGATGCATTGTTTTAAATAGGTAAAGCTAAAATAGCTTTCCTGTTTGTAATCCATGATGATTCTTTC
AAAATTAGGATTTTTAACATGGAAAGATATTTGGTCGACACGCTCTTTTGGCGTAAGGGTCCCATCTTCA
CTGATATCAACCAGTTTATTAATGAGCTCTGTCTTTTTCGCCAGTGTCTCTTCGCTTTCAAATGTCGAAT
TATTTTGCTCGATGGCAGCGGTAGAAAGACTAAAGTAGTTTTTAAATTGAGCTAAAGCAACTCTTACTGC
ATCAAGATGATAATATTTTTCAAAATTATCTCTTTCAAAATTTTTAATTTTTTCCTTTAGCAAATTTTTT
ATAGTTAAATTAATATCTTCTGCGGATTTTGAGCGTTGAATAATACTTTCTTTGAATGTCAGTAAATATT
CTCTAAGTTTTGTGCGATATTCCTTGTCAGTGTATTGTAAACCTATATGACGGTTGCAGAAAGCATCTAA
TTGTTTATTAAATGATTCTGTAGTGTATTCTTCTATATAAAGGAGATCTTCTTGTTCCTGAGTCGATCGT
AACTCTTTAAGATAACTCAACTTTTCTCTGGCAGTATTTGCTTTCATAAGATAAGTGGCTTTTAGGCCTT
CATAATGATGGTAGCTTGAGATAATGAGAGGCTTAATGAGCGTTAATTTAGGTTCATACTCTTTCAGCTC
TGAATTTAAAAGAGTGTCTAATTCATAATCTTTAGGATCATGATCTGTATTCTGGGGTAATCGCTTTTGT
AATTTTACCAATTTGTACAGAGCTTTTTTATAAGTTTCGATTAATTCATCATCAGTGGTTTTGCCGCCTT
TTGTTTTGATAATTTCATATAGCTTGATGATATGTTTATAATTTTTTTCTATTTTATCCAAATGTTGTGT
TGCATTTTCAAGTTTTTTATTCGTTGTTTTTATTCTTTGATCTATTGGTGTTTTATCACATATCATTCGA
ATATGTGCTTTGGAATGCAGCGCTAAAGGATGTAACAGGCCTTTATAATATTCATCCGTTATTGTTTTTA
ATGGTCCTGAGATAGTACCTGGTACCAAGCCTAATTTATCTTCCCATGCGTCCGCTTCCATCAGCATGGG
TGTAAAAATCTTGGAGCGGAATTGATCCAGATTATTCATTACGGCGTCATGTGATGTGCTAATAAATTCA
TTCAGTTTGTTCGTCATTTCTCTATAGAGAGAATACATGGCAGGCGTTTGTAAGAATAATTTGAAATAGG
AGTTTGAACTTTTAATGATATTTTCTACAGTAACGGTTGCTTTTTTTGCCTTTAAGTGTAAGTCGTTGAG
TTCTTCTGTCGTGAGATAGTTGGTATTTCTTAAACTTCTAATGTGTTTTGGTGAAATATAAAAAGCATTG
AGTGTATACCAGAGAGCATTGTATTTAATATCCTGGTTATAAGGTACTTCTAAGGGGGATACCTGATACG
CATCACTGTGTTCTTGTATTGTTGCAATAAGAGTTTGTGCTTTTTCCAGTAACTCGCTTGCTATGAGCTT
AAAATGAGGATCCACAGCGAGTTTTAGCGCTAATTTCTTAATTTCATTAATGTGATCATACGCTTGTACT
AAATGATAGACATAAATGCTTTCGTAACTTCTGGTGTCCAGTTTTTCCAGCTCAACAACAATCTTTTCAA
CATGATAGAGGCTATTGAATATGCGTTTTATTGCAACAACCTGTTCACTCTGGGCAAGTTCTTTGTTTTG
ATCTTGCAATTCAGGGTAAGGTACTCCATTGGATTGTTGTTTTAATTGTGCCCTCATCGCATTATTAAAA
AACGAAATGACTTGATTAAGCTCCGTTCTGAACTCATGTATGCATTTAGAGAAATTGGTATGTTTAATTA
AATGATGGGCTCTGCTTTCCAGTTTTTCATCATGTTCAAGTTCGGTTGAGTTATTTTCACTGGCAAATTT
TTCCTGGGCCCATTTTAAATATTGATTACTCTTTTTACCCCATTGTAAATCAATTTCTGTAAAATAAATT
TGAAAGTGTTCATCCAGTTTTTCAAACAGGTCAACTGCCGGAGCATCATAGGTGGATGACTCATTAGAAA
AGGAATGGACCAAAAATTTGTCAAAACTTATTGCGGAAGCTCTGAGTTCAGGAGGTATCCCATCGATAAA
ATAAGGTTGAAATATATTATATAAATTACGGCAGCGGGTTTTGGTCTCTTTATCAAGATTATTTAAATGG
AGAATCCTGCCTTCCGTTTCAGCGATTGTCTTGGTTTGCTTTTTTAATAAGGTAATAAATTCGTTATATG
CTTTGCTGGCAACTCTGAATTTTTCACGTTTGTTTCTATACCATTGATAGAGGTCAAGAGCCTGTTCAGA
TGTTAAATTCTCAGGATTAACCAGTATATTATGTCCTTTCTCTGGCCTGAATTTTAGTTTGTCCGTAGCG
CCATTAGCAGGGTTTAGTGCTTTTGTCTCATCTAGAAGAAAGACATTCGTTTTTTCACTATAAGGGAATA
AAACCAGATTTGTTTGTTTGTGAACAGACTCGATAAGGTCTCTATTCAATTCGATATGAAATTGTTGAGT
GGCTTTCTTTTTGCTAATTAAAGTTTGTAATGCTTCCTTTTGCGCTAAAACAAAACTGGCGTGATCGGCT
GGAAGACTGCCTCTTAACCAACGCCATGGCTTCTTTAAATAAGAAGACCAGGATTCCGGGCCCTGAAAAC
TATCGATCAACAAAATATTGAGATCAGGATCCACATCCATCATATAAGGACTGATTATTTTGTAATATGT
AATCAGTTGGTTTTTAATTTCTTTCGGTAATTGATGTATGGGTTGTTTATTATAGGGGGGGGTGTCCAGT
ATTTTGTAAAAATTATCCAGAGCTTCTTGCGCTTTTTGAATTTTAAAAAGGGCTTTGTTAGCTTCATCAA
TTCGTTGATATGTTCTTTCCAGTCTTAAAGCGAGAAAACGGGAGTCCTCTATACTGAGTAACTCTTCTCC
TTTTTCTTTGAAGTTGACGGGTTTGGATGCGTAATAAATTAAAAGTTGGTATAGAGGCTTGATTTTTTCC
ATTAACGGAATGGACAGTGTACCAGGCTTCAGCATGGCATTGTCTTCAATTTTATCCACTAACCCAAATA
AAGTAGGTAATACAACGTATTTTAATTGAGCCAAATTATCACGAATGACATCCTGGGATGAATCGCTGAA
ATGTCCCATTTGTTCAACAGAGCTTGTCGCCAATGTGATGATATTACGGATAATGTGAATGTATTTTAAA
ACTTTAAGGGATATAAAAAAGTCATTCCCTTTCAGATGCTCCAGGTCATTTAGTAATTTTAATGATGCGT
TTTGTAACTCTTCCAGCTTTTCATTATTTAGGGTAGGCTCTTTTTCTTTGATTTGTGAAGAGTATTGTTG
AATGTATTGAGTTAATTTTTCTATATAACCAGGTAATACGGCACTGAATTGAGTGAGGAATTGGTAATCC
CAATCTCCTGTTCTCGGTTGCATTTGCTCTAAAGCAATGCCTGTAACTTCTCCTGCTTTATAGCTTATAG
GAAAATCCTTCAAAGACTCTGCCAAACGCTTGGTGCATTCCTGGTGTTCACCAGCAAAAGCTTGTAATTT
TCCAATGACAGGAAGAATAAGATCAATCTCTTCCTTGAACATTTCCTGCAAATCAACATCCAGGTTAGTG
ATTAGATAACCGGCTTGATAGGCCTGGTGAATCGTGTTGCTATAAAGTAATTTGAGGTCAGGGATAGTTC
GTTTGATGTTCCCTATGTCAATATTCTCTAAATCCAGAAAAGCTAAACGGGCATGGTAAAGGGCGTTAAT
GAGTTTCTTGATTTGAGAAATATTTTCCGGGTCAAGATCAAAATCGGTGAATGGAACCCCGTCTTTATTC
ATTTTTTCCAAGTAGGGGGCCAGTCTGGGGTTGAAATGTCCACTTTTTAAAGTCGCAAGGATTTTTGAAT
TAATTTTTTCAATTAATTTAGAGAATTGGTTTTGCTTAAAGGATTCTAAAAGCTTGATCTTTTCTGAAAT
CA
Protein Sequence
>gi|54296413|ref|YP_122782.1| SdhA, substrate of the Dot/Icm system [Legionella pneumophila str. Paris] MISEKIKLLESFKQNQFSKLIEKINSKILATLKSGHFNPRLAPYLEKMNKDGVPFTDFDLDPENISQIKKLINALYHARLAFLDLENIDIGNIKRTIPDLKLLYSNTIHQAYQAGYLITNLDVDLQEMFKEEIDLILPVIGKLQAFAGEHQECTKRLAESLKDFPISYKAGEVTGIALEQMQPRTGDWDYQFLTQFSAVLPGYIEKLTQYIQQYSSQIKEKEPTLNNEKLEELQNASLKLLNDLEHLKGNDFFISLKVLKYIHIIRNIITLATSSVEQMGHFSDSSQDVIRDNLAQLKYVVLPTLFGLVDKIEDNAMLKPGTLSIPLMEKIKPLYQLLIYYASKPVNFKEKGEELLSIEDSRFLALRLERTYQRIDEANKALFKIQKAQEALDNFYKILDTPPYNKQPIHQLPKEIKNQLITYYKIISPYMMDVDPDLNILLIDSFQGPESWSSYLKKPWRWLRGSLPADHASFVLAQKEALQTLISKKKATQQFHIELNRDLIESVHKQTNLVLFPYSEKTNVFLLDETKALNPANGATDKLKFRPEKGHNILVNPENLTSEQALDLYQWYRNKREKFRVASKAYNEFITLLKKQTKTIAETEGRILHLNNLDKETKTRCRNLYNIFQPYFIDGIPPELRASAISFDKFLVHSFSNESSTYDAPAVDLFEKLDEHFQIYFTEIDLQWGKKSNQYLKWAQEKFASENNSTELEHDEKLESRAHHLIKHTNFSKCIHEFRTELNQVISFFNNAMRAQLKQQSNGVPYPELQDQNKELAQSEQVVAIKRIFNSLYHVEKIVVELEKLDTRSYESIYVYHLVQAYDHINEIKKLALKLAVDPHFKLIASELLEKAQTLIATIQEHSDAYQVSPLEVPYNQDIKYNALWYTLNAFYISPKHIRSLRNTNYLTTEELNDLHLKAKKATVTVENIIKSSNSYFKLFLQTPAMYSLYREMTNKLNEFISTSHDAVMNNLDQFRSKIFTPMLMEADAWEDKLGLVPGTISGPLKTITDEYYKGLLHPLALHSKAHIRMICDKTPIDQRIKTTNKKLENATQHLDKIEKNYKHIIKLYEIIKTKGGKTTDDELIETYKKALYKLVKLQKRLPQNTDHDPKDYELDTLLNSELKEYEPKLTLIKPLIISSYHHYEGLKATYLMKANTAREKLSYLKELRSTQEQEDLLYIEEYTTESFNKQLDAFCNRHIGLQYTDKEYRTKLREYLLTFKESIIQRSKSAEDINLTIKNLLKEKIKNFERDNFEKYYHLDAVRVALAQFKNYFSLSTAAIEQNNSTFESEETLAKKTELINKLVDISEDGTLTPKERVDQISFHVKNPNFERIIMDYKQESYFSFTYLKQCILSLLEALCLYTPERRKLFNNLESSVKTQPKINELTKRFGLFAGNESAISTESRAITPVSSIENNGTIELN
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: sdhA mutant is attenuated in mouse macrophages (Laguna et al., 2006).
References
Laguna et al., 2006: Laguna RK, Creasey EA, Li Z, Valtz N, Isberg RR. A Legionella pneumophila-translocated substrate that is required for growth within macrophages and protection from host cell death. Proceedings of the National Academy of Sciences of the United States of America. 2006; 103(49); 18745-18750. [PubMed: 17124169].