Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

dotA from Legionella pneumophila str. Paris

Victor ID 1474
Gene Name dotA from Legionella pneumophila str. Paris
Sequence Strain (Species/Organism) Legionella pneumophila str. Paris
NCBI Gene ID 3117985
NCBI Protein GI 54298676
Locus Tag lpp2740
Protein Accession YP_125045.1
Other Database IDs UniProtKB-ID: Q5X1K3_LEGPA
UniRef100: UniRef100_Q5X1K3
UniRef90: UniRef90_Q5X1K3
UniRef50: UniRef50_Q5ZS33
UniParc: UPI0000445260
EMBL: CR628336
EMBL-CDS: CAH13893.1
RefSeq_NT: NC_006368.1
GenomeReviews: CR628336_GR
KEGG: lpp:lpp2740
LegioList: lpp2740
eggNOG: NOG41268
HOGENOM: HBG520268
OMA: LQASERI
ProtClustDB: CLSK833557
BioCyc: LPNE297246:LPP2740-MONOMER
Taxonomy ID 297246
Gene Starting Position 3121605
Gene Ending Position 3124712
Gene Strand (Orientation) -
Protein Name defect in organelle trafficking protein DotA
DNA Sequence
>gi|54295983:3121605-3124712 Legionella pneumophila str. Paris, complete genome
GTTATTCGGGAGGTGGTGTACTAGTTGGAGCACCGCTGTCTGAACCACCCAGTTGTTGACCTGTATCGGG
TTTAGAGCTTGGGCCAGTTTGGCTGCCACTGTTTTTACCTTTTCCTGAAACATCACCCGCATTTCCTGCA
ATCTCTTTAGCTTGGGGTCCAAATTTGCCTAGCATTTCTTGGCCTTTAGCTCCCAATTTGTCGCCAATAG
CTTTCTCAGCTCCATAAGTAGCTTCGCCTGCTTTCTCTACTTTACCCTTGGCTTCTTCACCCCATTGCAT
GGTTTCCTGACCAAAAGATTCGGGGTTGCCGCCTATCCATCTCAACACTTTATCTGGCAAGTGAGCAATC
AGCGTGAAGGCTTTTTGCACGATAATTAAATACATGGTGGTATAAATTAAGATGGAGAAGAAGAAAGCAT
ACACTCCTGCCCACCCCGAATAACCGCCCTGCAATGCAGTTGACTGATAATCACCGCTCAATTTGGATCC
AAAATCATCCCATTGCGATGTGTCTATTTTCGACCCTGTCCAATTCGCGACCGTCTGCCCTGCCTGTATC
ATTTTACAGTCAGCAGGATACATTTGACAGTATGCAGAATTAGCATTTTTGTCTGCGAAATCACCTTTTT
TCCATGTTTCTATTCCTTGATCCGATTGGATGTAGGAAATGGCATGATCAAATCCGGCATTCAAAATCCA
GACTCCGACATAGGACAAGGCAATTGCTGTAATATATCCTATTATCATCAGAGAAGGTCTTAAAAAGACA
TTAACCAAAATCATAATGGCAAATTCGCCTTTACCAAAAGCCTCATTACCTTCCGGATGCGTAACACCCA
AAGCGACAATTGGGGCAGCAACCATAGCCTCGATAACGGCTATCAGCCAGGCAAATGATCCAAAAGTAAA
AATCATATAAGGTAAAACGGGTATATAATATGCTGTAACAAATCCTATGGATACCATGGTTCCTATCCAT
GCCATTAACAGGGGCATAGCCATCATAATCAAGGCAAAGATAAAGATACCAAAAAGTGGGATTAGTGAAC
TGACCACGGCCATATTCAACAGTGTTAACCACAAAGTACCAGAAAAATTAATATACATCGTCCCCATATT
AGCCAACGCGACTATGGGGTTTACTCCAGGTTGCGCAAGAGTTTGAACTCCCACTATGAAAATATCTTTC
ATGCCTTGTAAAGGAATCATTAAAAAGGCCATGACTATGGAATTAATCATTTCCCCGAATATAGCTAGAA
AGAAATTGTACACGTACCTGAAAACATAGTTATAAAATAAATCACCCATCATGCGGCCAAGGCAAAAAGA
GAAGAACAAAATCTTCACCCTGCCGCAATCAAAATCCTGGTGCTTCATGTAATAAAGCGAGGTATCTACT
TTAAAATTAATAAGATTGGCAAAGGTTAACGGTTTTATTCCCGGCTGGCCTGGCAATTGGACCATCATGG
AATTGTTGATAAACCCATAGACTGTTGAAGACAATGGTCCTTCAACATAAGCACGTTTAGGGTCAGGACT
TAGATCAGGTTGCTTGACCCCATCCTGACTCAAGGCCGGTGCCCCATTGATTAATGACTGGACTTGAACC
AGCTTATCGCTCTTGTTTTGAAACCAGTTGCACAATAAAGCATACGTGCCCTGACACGTTTTCCCAAATG
GCTTGGTGAGTTGTGCTGGATCAAAATTACTATTATCAAGGCCTGTGTCACTATCAAAATCACTCTCATC
TTTTACTGCACTTCCATTGAGTTTCACCAAATCAAAAAAATAAGAACCAGCCATGATCCACCCTTTGGTA
TTGGCTTCTTGGATAAAATCACGGGATTTGTCATCATATTCAGCAGATTTAGATTGTTTTATCAGATTAA
TGGTTGGCGTCATAATGCCATTGTAGTCATTAATCGCCCCTAAAAATTCAGTACCATTAAATAATACCCC
CGGAGTAGATCCGGTAGAACTGGGTATCGATCCCCATGTTTGGCAAACTTGTTGATACTCAGTGCAGACC
TGACCAGATGCCTTATAAGGCACTCCAAACTGCTGTTTGGCAATGGCTGAAAAATCATTTTTTGAGTTTC
CGGTAGACGAAGTTGATGAAAAGGCCGGATCATTATTAACCATCACCTGTGCCACCGTAGATAAAGTCAC
ATACATTTGCTGTATAGCAATCGCGCGAGACAATTGAGCTGTTTCCAACTGGGAAGAAGTAAGCTTTATG
TTTTTTCCCATATCAGCCTTCAAATCAGAAATACTATTCCATGTTACTGTGCCGCAAATCCCATTTAAGA
AATAAAATGGTGAGCTTTTATCAAAGTTTGGCATATCAAGGCTAAATGGTCCTTTAGACTTGTCATCGCT
TTGCTTCTTGACAAAATTCACTGTACTGATGAAGTCAGGAATCGCTGTACGGCAAAAAGTATTCATTTCA
GGAGTAGGATTACCCCCACAAGGAGGGCTGTTACTTTGGCTCAGATAAAGATTCCTTTGCGTTTGTAATT
GTTTTTGTAAACCCAACATGCAGACTTGACCAGACAATATAGTAAATGCCCCTTTTGCTATACCTGTAGA
CTTCCCACCTTTATCTGTGAGGCTCTTGGTTGGGTCAGACTGAGCCTGTATTATCACACCACCCCGATTC
AGATAACTCAAGGCAGCTTCCCATATTTTATCAGCTGCACCAACACCCTGCACAATAACCCACATAAAAA
ATACCTGCATCATACAATAACCAGATGCTTTAGGTATTAACAAAGCCAAACCGAAGGTGGAACGAAGAGG
AATCCAAATTGAGGACCATTTTTGGCCTAGCATTTGCCCTTCATGGGCTGTGTTCATGGTGGAAACCATG
AGGGTATACATAATGATGATTCCACCCAAAGCAAGGACAGCGGAGTTGAAGACACCAAACATGTTGCCCA
TTATCTGGCTTCCCGTTCCGTGCAGTACCCCATCGACTACACCAAACAGGTTACCTAAAAAAACGACGGA
CAAATCGCTTGCTGGAGGCGCGAAGCTTAAGGCGCCACTTTCAGCGAGAGCAAGCGCAGGAAAAAAGCAA
AGGAGGACCGTAATAGCTAATTTATTCA
Protein Sequence
>gi|54298676|ref|YP_125045.1| defect in organelle trafficking protein DotA [Legionella pneumophila str. Paris] MNKLAITVLLCFFPALALAESGALSFAPPASDLSVVFLGNLFGVVDGVLHGTGSQIMGNMFGVFNSAVLALGGIIIMYTLMVSTMNTAHEGQMLGQKWSSIWIPLRSTFGLALLIPKASGYCMMQVFFMWVIVQGVGAADKIWEAALSYLNRGGVIIQAQSDPTKSLTDKGGKSTGIAKGAFTILSGQVCMLGLQKQLQTQRNLYLSQSNSPPCGGNPTPEMNTFCRTAIPDFISTVNFVKKQSDDKSKGPFSLDMPNFDKSSPFYFLNGICGTVTWNSISDLKADMGKNIKLTSSQLETAQLSRAIAIQQMYVTLSTVAQVMVNNDPAFSSTSSTGNSKNDFSAIAKQQFGVPYKASGQVCTEYQQVCQTWGSIPSSTGSTPGVLFNGTEFLGAINDYNGIMTPTINLIKQSKSAEYDDKSRDFIQEANTKGWIMAGSYFFDLVKLNGSAVKDESDFDSDTGLDNSNFDPAQLTKPFGKTCQGTYALLCNWFQNKSDKLVQVQSLINGAPALSQDGVKQPDLSPDPKRAYVEGPLSSTVYGFINNSMMVQLPGQPGIKPLTFANLINFKVDTSLYYMKHQDFDCGRVKILFFSFCLGRMMGDLFYNYVFRYVYNFFLAIFGEMINSIVMAFLMIPLQGMKDIFIVGVQTLAQPGVNPIVALANMGTMYINFSGTLWLTLLNMAVVSSLIPLFGIFIFALIMMAMPLLMAWIGTMVSIGFVTAYYIPVLPYMIFTFGSFAWLIAVIEAMVAAPIVALGVTHPEGNEAFGKGEFAIMILVNVFLRPSLMIIGYITAIALSYVGVWILNAGFDHAISYIQSDQGIETWKKGDFADKNANSAYCQMYPADCKMIQAGQTVANWTGSKIDTSQWDDFGSKLSGDYQSTALQGGYSGWAGVYAFFFSILIYTTMYLIIVQKAFTLIAHLPDKVLRWIGGNPESFGQETMQWGEEAKGKVEKAGEATYGAEKAIGDKLGAKGQEMLGKFGPQAKEIAGNAGDVSGKGKNSGSQTGPSSKPDTGQQLGGSDSGAPTSTPPPE
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: dotA mutant is unable to replicate in mouse macrophages (Vincent et al., 2006).
References
Vincent et al., 2006: Vincent CD, Buscher BA, Friedman JR, Williams LA, Bardill P, Vogel JP. Identification of non-dot/icm suppressors of the Legionella pneumophila DeltadotL lethality phenotype. Journal of bacteriology. 2006; 188(23); 8231-8243. [PubMed: 16997951].