Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

ptsP from Legionella pneumophila str. Paris

Victor ID 1478
Gene Name ptsP from Legionella pneumophila str. Paris
Sequence Strain (Species/Organism) Legionella pneumophila str. Paris
NCBI Gene ID 3118937
NCBI Protein GI 54298863
Locus Tag lpp2930
Protein Accession YP_125232.1
Other Database IDs UniProtKB-ID: Q5X116_LEGPA
UniRef100: UniRef100_A5II44
UniRef90: UniRef90_A5II44
UniRef50: UniRef50_A1TYU3
UniParc: UPI00000BD9B6
EMBL: CR628336
EMBL-CDS: CAH14083.1
RefSeq_NT: NC_006368.1
GenomeReviews: CR628336_GR
KEGG: lpp:lpp2930
LegioList: lpp2930
eggNOG: COG3605
HOGENOM: HBG456539
OMA: LGHRLMR
ProtClustDB: CLSK914860
BioCyc: LPNE297246:LPP2930-MONOMER
Taxonomy ID 297246
Gene Starting Position 3343054
Gene Ending Position 3345348
Gene Strand (Orientation) -
Protein Name phosphoenolpyruvate-protein phosphotransferase PtsP
DNA Sequence
>gi|54295983:3343054-3345348 Legionella pneumophila str. Paris, complete genome
ATCATGACTTTCCTGCTCTGATTAATCCCCCTAATCCTTCCTCTTCTAAAGCCTTTTGCAAATGAAATCG
TATTTCAGCAGGATGTTCAAATTCCAAAACTTCTGCCAGAATTTTACGGGCATTCGCGATAGCAAAATTG
CGAATAACCCATTTCACCCTGGGTAAACTGGCGGAATTCATGCTTAGGGTGTCAAAACCCATAGCAATTA
ACAAGATCACCGCTAAAGGATCGCTGGCCATTTCGCCACAAATACTCACCTCAACACCAGCTGCATGCCC
TCCTTCGACTATTTTTAGCAATGTACGCAACATGGCTGGATGCAAGGGATCATAAAGTGCGGCAACTCGG
GCGTTATTTCTATCCACAGCCAATAAATATTGAGTAAGATCGTTACTACCCACCGAAATAAAATCCACTC
GTTTCGCCATTTCTCTTGCCAGATAAGCAGCGGCAGGCACTTCAATCATCACACCAATTTTGGGTTTTAC
TATTTCGCACCCCTCTTCCACCAGCTCTTCAAATGCCTGTTCAATCAAATAAACGGCTTCCTCTACTTCG
CTAAGCGTAGTGACCATAGGCAACATGATACGTAAATTATCCAGTTCCTCACTGGCACGCATCATGGCAC
GAACCTGAATCAGGAAGACATCTGGATGATCAAGAGTTATCCTTATTCCACGCCATCCTAAATAAGGATT
TTCCTCTTCAACTGGAAAATAAGGTAGAATTTTGTCGCCACCAATATCCAGGGTACGCATAGTTACCAAA
CGTGGAGCAAAGGCCTTGAGAGTCTGTCTGTAAATAATGGTCTGCTCATCTTCTGAAGGGAATCGATCTC
GACTCATAAATGGTACTTCTGAACGGTATAAACCAACTCCTTCAGCGCCAACACTCATTGATAAACCGGC
ATCCATTGCCAAGCCAGTATTGACTTGCAAAGAGACTCTGTAGTTATCAGTAGTTTCGGCCGGTTTATCA
CGCAAGCTTACCAGGCTTTGGTTTAATTCCTGTTCTTCTTGAGCTAATTGCTTAAATTCCGCTAATAATG
ATTTGGAAGGAGAGATATAAACATGCCCATAATAGCCATCAACAATCAAAGCCCGACGCGATACTAACTC
TACTTTTAATCCTCTCAACCCCATCACAGTAGGTACACCGAGAGCTCTCGCTAAAATAGCGACATGGGAG
TTATTGGAGCCTTTAGCTGAAACGACACCAGCCAATTGCCCTTCTGGAACTTCTGCCAGAGCGGCAGCAG
TAATTTCTTCTCCTATTAAAATGGTTCTCTTCGGATAAACAATTTCTTCTCTTTGGGTACGTTGTAATTC
CGCCAAAACTCTTCGGCCCAAATCACGGAAATCGCTGGCTCGTTCGCGCAGATAATCATCGCCCATGCTT
TCAAATTGCTGCACGTGTTTCTTGATCACTGTAGCAAGGGCAGCTTGAGCGCTGATTTTCTCTTCACGAA
TCACATGCTCTACTTCAGCACCCAAGCTATCCCTATCCAAAATTCTTAAATACACATCGAATAAAGCATG
CTCTTCCTCAGCAACAGTTTCTTTCATGCGTTTACTTAAACGCCTGATATCATCTCTTGTCGTTTCCAAA
GCTTCATAAAACGCATTGATTTCATCTTCCAATTCTTCAACTGGATTACGAGGGACAGCATCAATATCCG
CAGGTGGGTACACAACCACGGCAGTACCAATTCCTATACCAGGAACACTGCCTATTCCAGTCAGTGCAGT
ATAAGCTGCTTCTACCTTGTCAACTCCTATACCCTTTTTAGGTTGTGTTAACTCGGCCAATTCACCTGTT
GCCTCTGCATGAGCAATAATCCCGCCTAATTGAGCCGCCAAGGTAATAAGAAAGGATTCTTCAGCATCAT
CAAAATGACGTTGTTCAAGCTGTTGTACAACTAAAACACCGTATAATTTTCTATGTTGAATAATAGGGAC
GCCTAAAAAAGCGTTCAGGTGATCTTCGCCAATTAAAGGGTTATGATAAAAATCCGGATGAGAGGGAGCA
TTTTCTATATTGATAGGTTCCTCTCTTCGTCCTATCAACCCGATAAGGCCGCAATCAAGAGCAATTCTGA
CTCTAAACTCTGCCTGCTTGTTCAAACCTTCCGTGGCTATCAATACGTATTCAGCATTTTTATTATCAAT
AAGATAAACGGAAACAGCCTCTGCATTAATGGCTGTATTAATACGTTGCACCAAAATACCAAGTGCTTCT
TTCAAATCACTGGCAGCGGTAACATCTTGTACTATCCGTTTAAGTATTTTAAGCA
Protein Sequence
>gi|54298863|ref|YP_125232.1| phosphoenolpyruvate-protein phosphotransferase PtsP [Legionella pneumophila str. Paris] MLKILKRIVQDVTAASDLKEALGILVQRINTAINAEAVSVYLIDNKNAEYVLIATEGLNKQAEFRVRIALDCGLIGLIGRREEPINIENAPSHPDFYHNPLIGEDHLNAFLGVPIIQHRKLYGVLVVQQLEQRHFDDAEESFLITLAAQLGGIIAHAEATGELAELTQPKKGIGVDKVEAAYTALTGIGSVPGIGIGTAVVVYPPADIDAVPRNPVEELEDEINAFYEALETTRDDIRRLSKRMKETVAEEEHALFDVYLRILDRDSLGAEVEHVIREEKISAQAALATVIKKHVQQFESMGDDYLRERASDFRDLGRRVLAELQRTQREEIVYPKRTILIGEEITAAALAEVPEGQLAGVVSAKGSNNSHVAILARALGVPTVMGLRGLKVELVSRRALIVDGYYGHVYISPSKSLLAEFKQLAQEEQELNQSLVSLRDKPAETTDNYRVSLQVNTGLAMDAGLSMSVGAEGVGLYRSEVPFMSRDRFPSEDEQTIIYRQTLKAFAPRLVTMRTLDIGGDKILPYFPVEEENPYLGWRGIRITLDHPDVFLIQVRAMMRASEELDNLRIMLPMVTTLSEVEEAVYLIEQAFEELVEEGCEIVKPKIGVMIEVPAAAYLAREMAKRVDFISVGSNDLTQYLLAVDRNNARVAALYDPLHPAMLRTLLKIVEGGHAAGVEVSICGEMASDPLAVILLIAMGFDTLSMNSASLPRVKWVIRNFAIANARKILAEVLEFEHPAEIRFHLQKALEEEGLGGLIRAGKS
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: ptsP mutant is attenuated in guinea pigs (Higa and Edelstein, 2001).
COG COG3605T, under T: Signal transduction mechanisms
References
Higa and Edelstein, 2001: Higa F, Edelstein PH. Potential virulence role of the Legionella pneumophila ptsP ortholog. Infection and immunity. 2001; 69(8); 4782-4789. [PubMed: 11447151].