Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

feoB from Legionella pneumophila str. Paris

Victor ID 1481
Gene Name feoB from Legionella pneumophila str. Paris
Sequence Strain (Species/Organism) Legionella pneumophila str. Paris
NCBI Gene ID 3119310
NCBI Protein GI 54298647
Locus Tag lpp2711
Protein Accession YP_125016.1
Other Database IDs UniProtKB-ID: FEOB_LEGPA
UniRef100: UniRef100_Q5X1N2
UniRef90: UniRef90_Q5X1N2
UniRef50: UniRef50_Q5WTE1
UniParc: UPI0000445243
EMBL: CR628336
EMBL-CDS: CAH13864.1
RefSeq_NT: NC_006368.1
GenomeReviews: CR628336_GR
KEGG: lpp:lpp2711
LegioList: lpp2711
eggNOG: COG0370
HOGENOM: HBG731320
OMA: AMMYLMF
ProtClustDB: CLSK833536
BioCyc: LPNE297246:LPP2711-MONOMER
Taxonomy ID 297246
Gene Starting Position 3091261
Gene Ending Position 3093516
Gene Strand (Orientation) -
Protein Name ferrous iron transporter B
DNA Sequence
>gi|54295983:3091261-3093516 Legionella pneumophila str. Paris, complete genome
ATCACGTATTTGCAGCAGCATTTTGCCTCCCCATACCATACTGGCTATAACGAAATACAGCTAAAACAAA
AAGCAGGCTCAGTGACATAGCCAAAATCCAGATCATACTTTGTTGAGGATGATCCAGAAATTTAGCGCCT
TGATAAAAGACAACGGAAGTGGTGTAAGCCACGACAAATGACCAAACAATGGAAGTCCACATAAATCGCT
TGTTTGCCTCCTGGCGAATCACTGCCATAGTCGAAACACAAGGGATATAAAGCAAAACAAAAAGCAAATA
AGCGTAGGCTCCTACAGCTCCATCAAAACGTCGTGACATAATGCCATAGACAGATTGAGATAACTCACTA
TCAGCTGCACTGGCAGAAACAGGGTTCCACAATGCAGAGCCTAATTCAGACAAATTGGCGGGAATAGACC
CAAAAGCAGCTTTGATGCCCCCCCAAAAATCAAAGTGAGCAGCAGCTATTTCTCCCACATGGCCTACTTG
GGCATAAAGTGAGTTTAAGGTGCCAACCACTACCTCTTTAGCCAGCATGCCAGTTAATAAACCGACAGTC
GCGGGCCAGTTGTCTTGATGAATTCCCATTGGAGCAAATAATGGAGTAATCCACTGACCTATTATTGACA
ATAAAGAATCCGTATTGGCTTCTCCGGAGCTAATCCCTCCTCCCCAAGTAATCGCATTTAATCCTCCCAG
AATCACACAAATGGGAATAATCAGCTTACCCGCACGATAAACAAAAAATCGTAATCGCAAGGAGGTTTCT
CTCAGCAATCTTCTGAGTGAGGGTCTATGATAAGCGGGTAACTCCAAAATCAAAGGAGAAGCATGTCCCT
TCAACGTAGTTTTGCGTAAAATATATCCGGTAAATACGGCCATTAAAATGCCAATCAAATACAACGAAAA
AACAACATTATGCCCGCCAGAGGGAAAAAAGGCCGCGACAAATACTGCATAAATAGCCAGTCGGGCACTA
CAAGACATAAATGGACTCATCATCACAGTTAATAATCGATCGCGCTCCGAATCCAGGGTGCGTGCTGCCA
TAATGGCAGGGACATTACATCCAAAACCCACAATCATGGGTACAAATGATTTTCCTGGTAATCCCATGGC
TCGCATCGCTTTATCCACGACAAAAGCAGCTCTTGCCATATAGCCCGAAGTTTCCAATAAGGACAAAAAG
AAAAACATCGCGGCAATCACAGGAATAAAAGTAATGGTGGTATTAATTCCTTTGCCTACCCCATTAGCTA
CAAGCGCGATTACCCAATTTGGTGCATGGAGCTGTTGCAACAACCAACCACTACCCTGAACAAAGATAGT
CTCTGTACTAATGTCAAAAAAATCCTGGAATGCTCCCCCAATATTTATAGCAAACAAAAACATCAAATAC
ATCATCGCAAAAAATATGGGCAAAGCTAAAAAGCGATGCAAAACAAGTTTATCCAATTTAGCAGTGAAGT
GTTCGCTGGCATCACTATGCTTTTTTTGAACCAACGTAACAATTTCATGGATTTTTTGATAGCGAGCGTC
TGCCAATAACACATCAAGATTTTGTTCCGTTTCTTGAAGCTTTATAAGAAGACTCTCGGTAAAAGCTTTC
TCTCCTATCAAAGTATCCCCTTCGGCAAGCCTACGGGAGAAATAGTAGGCAAAGGAATTTTTATACCCTT
TTGAGATCAGCTGATTTTCCAGGTCATTCAAAATTTGTTGCGCTGCAACCGATAAGGAAAGTTTTAGAGG
TTTTATCTTTTGGGAGCAATGAAGTAATGATTGCTGAAGTGCCGGAATACCAATGTTTTTATGGGCCTGA
ATGGGAATAACAGAACACCCTAACAAACTCTCGAGTTTCTCTGTATCAATAGAAATACCCCGATGCTCGG
CAATATCCATCATGTTAAGTGCTACAACAACAGGTTTACCTAACTCAAAAAGTTGGCTGGTTAAATACAA
ATGTCTTTCAAGGTGACAAGCATCTATAACATTAATGATGCAATCGTATTCCAAATCAATAACTGACTGA
GCAGCAATTTGCTCATCCTGGCTTATTCCTTCGGCATTCGCAACCAGAGAATAGACACCTGGCAAATCAG
TGATTTCAATTAAATGTTCTCCAAGCAAAAATTCACCTGTTTTTTTCTCAACAGTTACTCCGGGCCAGTT
GCCTACGCGTTGATTCGCATTGGTCAAAGCATTGAATAGGGTTGTCTTACCACAATTGGGATTTCCTATT
AATAGGGCATGAGTCA
Protein Sequence
>gi|54298647|ref|YP_125016.1| ferrous iron transporter B [Legionella pneumophila str. Paris] MTHALLIGNPNCGKTTLFNALTNANQRVGNWPGVTVEKKTGEFLLGEHLIEITDLPGVYSLVANAEGISQDEQIAAQSVIDLEYDCIINVIDACHLERHLYLTSQLFELGKPVVVALNMMDIAEHRGISIDTEKLESLLGCSVIPIQAHKNIGIPALQQSLLHCSQKIKPLKLSLSVAAQQILNDLENQLISKGYKNSFAYYFSRRLAEGDTLIGEKAFTESLLIKLQETEQNLDVLLADARYQKIHEIVTLVQKKHSDASEHFTAKLDKLVLHRFLALPIFFAMMYLMFLFAINIGGAFQDFFDISTETIFVQGSGWLLQQLHAPNWVIALVANGVGKGINTTITFIPVIAAMFFFLSLLETSGYMARAAFVVDKAMRAMGLPGKSFVPMIVGFGCNVPAIMAARTLDSERDRLLTVMMSPFMSCSARLAIYAVFVAAFFPSGGHNVVFSLYLIGILMAVFTGYILRKTTLKGHASPLILELPAYHRPSLRRLLRETSLRLRFFVYRAGKLIIPICVILGGLNAITWGGGISSGEANTDSLLSIIGQWITPLFAPMGIHQDNWPATVGLLTGMLAKEVVVGTLNSLYAQVGHVGEIAAAHFDFWGGIKAAFGSIPANLSELGSALWNPVSASAADSELSQSVYGIMSRRFDGAVGAYAYLLFVLLYIPCVSTMAVIRQEANKRFMWTSIVWSFVVAYTTSVVFYQGAKFLDHPQQSMIWILAMSLSLLFVLAVFRYSQYGMGRQNAAANT
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: feoB mutant is attenuated in human macrophages (Robey and Cianciotto, 2002).
COG COG0370P, under P: Inorganic ion transport and metabolism
References
Robey and Cianciotto, 2002: Robey M, Cianciotto NP. Legionella pneumophila feoAB promotes ferrous iron uptake and intracellular infection. Infection and immunity. 2002; 70(10); 5659-5669. [PubMed: 12228295].