Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

flaA from Legionella pneumophila str. Paris

Victor ID 1482
Gene Name flaA from Legionella pneumophila str. Paris
Sequence Strain (Species/Organism) Legionella pneumophila str. Paris
NCBI Gene ID 3119334
NCBI Protein GI 54297249
Locus Tag lpp1294
Protein Accession YP_123618.1
Other Database IDs UniProtKB-ID: Q5X5M6_LEGPA
UniRef100: UniRef100_Q5X5M6
UniRef90: UniRef90_A5IBI3
UniRef50: UniRef50_P53606
UniParc: UPI0000444D3C
EMBL: CR628336
EMBL-CDS: CAH12445.1
RefSeq_NT: NC_006368.1
GenomeReviews: CR628336_GR
KEGG: lpp:lpp1294
LegioList: lpp1294
eggNOG: COG1344
HOGENOM: HBG758847
OMA: TDARDII
ProtClustDB: PRK12806
BioCyc: LPNE297246:LPP1294-MONOMER
Taxonomy ID 297246
Gene Starting Position 1440138
Gene Ending Position 1441617
Gene Strand (Orientation) -
Protein Name flagellin
DNA Sequence
>gi|54295983:1440138-1441617 Legionella pneumophila str. Paris, complete genome
ATCGAAGTGCAGCAACAGCTGCACTTCGATTGCGACATCCTATCGACCTAACAACGATAATACAGATTGC
GGTAGGCTATTAGCTTGTGCCAACATCGCTGTACCTGCTTGTTGCAGAATTTGGTTTTTAGTCAAACTGG
CCATTTCAGCAGCGTAATCAGCATCTTGAATACGACTTCTTGCAGCTGATAAGTTGTCTGATACGTTTTG
CAGGTTAGCTATAGTAGATTCAAAGCGGTTTTGCAAAGCACCCATATTAGCCCGATTAGAGTTGACACTA
TTAAGTGCTGCATCAATTCTCTTAATCGCTGTTTGAGCACCAGCCGCCGTACTCACATCCAGTGAATCTA
CACCTACTGTATCTTTGGCGATATTGGCACTTAAACCCACGTTGGCAACAGTACCACCGATTGCAATAGT
ATCAACGGCGCTGATTGATAATGTACCGCGTAGCGCGCCATCAAATGCGCCACCAGTCACAGTTAAACCG
TCAGTACCTGCAGTAAAACCTGTACCGCTTTCTGTTACCGTAATGTTTCTGCCATCAGCAGCAGTGAGTG
TCATATTACCTCCGTTAAGTGACGCGACAACTCCAGTTTGGTTACTGACACCATTGATGGCATCCCGAAG
ATCGGAGTTGGTTAATGCCGTTGCTACGTTAAGGTTAGTATATATTGCAACACCATTAATCGTTAAGTTG
TAGGTATCACCTGCGGTTCCACCTATTGCGCCAACTGCTTGTGTGCCGCTGGTAGATGCTGTAACTGATA
GTCCTCCTATCCCGGCATCGTTGATAGCCGCTGCTTTGGCATAGGCAGACGTAGCATCTTGCCCGTTTAG
TGCCCCGGTAAAATTGGCAGAAGAGTTAATACTGGTTGCTGCTCCTCCTCCAATTGCGATAGTGATATCT
GTCGCTGCTGCACCAGCTACTTCTGTTCCTGTTGCCGTGGCAATACCACCAATGGAAGAAGCTTTTATGC
TGCCGATACTGAAATTGATGGTTTGGTTTGAATTCGCTCCAACCTGGAAGCTTGCACCAGAGAAAGAGCC
ATCGAGAATTCTTTGACCATTGAATTCAGTATTTTGAGCAATACGCTCCAATTCACTTTTTAATTGTGAA
ATTTCGCTTTGAATTGAAGCCCGGTCAGATGAGTTATTGGTTGAGTTAGCAGCTTGAACGGAAAGCTCAC
GCATACGCTGCAAAATATTGGTTGTTTCCTGCATAGCTCCTTCAGCAACCTGAGCCAGAGAAATACCATC
GTTAGCATTTCTAACTGCTTGATTCATCCCGCGAATTTGTGCAGTCATTCGTTGAGAAATGGCGAGTCCT
GCTGCATCATCTTTAGCACTGTTAATTCTTAATCCTGATGATAAACGCTGGATTGATGTCTGCATCATGT
TGCCCGAAACACCTAAATTACGTTGGGCTGTAAGCGAAGCCACATTAGTGTTGATTACTTGAGCCATAGT
TTTAGTCTCC
Protein Sequence
>gi|54297249|ref|YP_123618.1| flagellin [Legionella pneumophila str. Paris] MAQVINTNVASLTAQRNLGVSGNMMQTSIQRLSSGLRINSAKDDAAGLAISQRMTAQIRGMNQAVRNANDGISLAQVAEGAMQETTNILQRMRELSVQAANSTNNSSDRASIQSEISQLKSELERIAQNTEFNGQRILDGSFSGASFQVGANSNQTINFSIGSIKASSIGGIATATGTEVAGAAATDITIAIGGGAATSINSSANFTGALNGQDATSAYAKAAAINDAGIGGLSVTASTSGTQAVGAIGGTAGDTYNLTINGVAIYTNLNVATALTNSDLRDAINGVSNQTGVVASLNGGNMTLTAADGRNITVTESGTGFTAGTDGLTVTGGAFDGALRGTLSISAVDTIAIGGTVANVGLSANIAKDTVGVDSLDVSTAAGAQTAIKRIDAALNSVNSNRANMGALQNRFESTIANLQNVSDNLSAARSRIQDADYAAEMASLTKNQILQQAGTAMLAQANSLPQSVLSLLGR
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: flaA mutant is less invasive of HL-60 cells than the wild type (Dietrich et al., 2001).
COG COG1344N, under N: Cell motility
References
Dietrich et al., 2001: Dietrich C, Heuner K, Brand BC, Hacker J, Steinert M. Flagellum of Legionella pneumophila positively affects the early phase of infection of eukaryotic host cells. Infection and immunity. 2001; 69(4); 2116-2122. [PubMed: 11254565].