Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

plaB from Legionella pneumophila str. Corby

Victor ID 1831
Gene Name plaB from Legionella pneumophila str. Corby
Sequence Strain (Species/Organism) Legionella pneumophila str. Corby
NCBI Gene ID 5180855
NCBI Protein GI 148359137
Locus Tag LPC_1029
Protein Accession YP_001250344.1
Other Database IDs UniProtKB-ID: A5IC98_LEGPC
UniRef100: UniRef100_A5IC98
UniRef90: UniRef90_A5IC98
UniRef50: UniRef50_D3HQ45
UniParc: UPI0001527C3E
EMBL: CP000675
EMBL-CDS: ABQ54998.1
RefSeq_NT: NC_009494.2
GenomeReviews: CP000675_GR
KEGG: lpc:LPC_1029
eggNOG: NOG14116
HOGENOM: HBG520456
OMA: PANHGSA
ProtClustDB: CLSK929571
BioCyc: LPNE400673:LPC_1029-MONOMER
Taxonomy ID 400673
Gene Starting Position 1101906
Gene Ending Position 1103330
Gene Strand (Orientation) +
Protein Name phospholipase
DNA Sequence
>gi|148358139:1101906-1103330 Legionella pneumophila str. Corby, complete genome
TATGATTGTTATCTTCGTCCATGGCTGGAGTGTCACGCATACCAATACTTATGGGGAACTTCCTCAATGG
CTTGAAAATCAGAGCAAACAGGGAAAGCTGGATATTCAAGTCGGCAATATTTATCTTGGGCGCTACATCA
GTTTTGATGATACGGTGACGGTTGACGATATAGCACGCGCATTTGATCAAGCGGTACGTGATGAAATTGC
TGATAAGCTACGAGATGGGCAGCGTTTTGCTTGTATCACTCACTCTACCGGTGGGCCCATTGTCCGCAAA
TGGATGGATTTATACTTTAAGAATAATCTTGCAAAATGTCCGTTGAGTCACCTTATCATGCTGGCTCCTG
CCAACCACGGTTCTGCTCTTGCTCAGCTTGGCAAATCCCGCCTAGGCCGCATAAAGAGTTTTTTTGAAGG
CATTGAACCGGGAAAGTGTGTACTTGATTGGCTTGAGCTCGGAAGCGATATGAGCTGGCAACTTAATGAA
AGCTGGCTTGATTATGATTGCACTGCCAATGGTGTCTATTCCTTTGTACTTACTGGCCAGAAAATTGATC
GCCAATTTTATGATGCAGTAAACTCCTACACAGGAGAATCTGGATCCGATGGGGTGGTACGCGTTGCTGC
AACAAATATGAATTATAGCTTATTGAAATTACATCAGGAGGGGGATAACGGTGAAAGTCTTGTTGTCGCC
AAAATGACACGAACACAGCCAATGGCATTTGGAGTTCTACCTGGACTTTCACATTCCGGTAAAAATATCG
GTATCATCCGTAGTATTACTATGGCCAATGCAGCCACTCACCCCACGGCGATATGGATCCTGCGATGCCT
GCAAGTAAAAAGTCGTGACTCCTATAATAAATTAGTAAAAGAGTTAGACAATATTACTAAAGAGACTCAG
AAAAATGAGCATAAGGAATTTGTGAAAACACTTGTCTTTACGCGCGAGTATATAACCAATCGTTACTCTA
TGATTATTTTCCGGCTTATTGATGACCGCGGCAATCACCTTATCGATTATGATCTTTACCTAACTGCCGG
ACCTCAATATAGCGAGCAGGCGCTTCCTGCAGGTTTTTTTGTAGATCGTCAGCGAAATCTCAATAATCGA
GGTAAACTGACTTATTTTCTTGACTACGATATTATGGAAGGTGGAATTAATACCCCAAAAATGCAGGGTA
ATCTTGGGTTTCGTGTTAAAGCATATCCTGAATCAAGTGACCAAGCCCTTGCCTATTACAGGTTACTTGA
TTTTCATTCATCGCTTGCTGACATTCACAAAATACTTCATCCGAATGAAACCGTAATGGTTGAAATCATG
CTTCAAAGACGAGTAGATAGGACAGTTTTCCGTATCAGCAACAACCTTACTCCGGCAAAAATCAGTGGAA
AGCCAACTGGCAAAAAGATAGATTG
Protein Sequence
>gi|148359137|ref|YP_001250344.1| phospholipase [Legionella pneumophila str. Corby] MIVIFVHGWSVTHTNTYGELPQWLENQSKQGKLDIQVGNIYLGRYISFDDTVTVDDIARAFDQAVRDEIADKLRDGQRFACITHSTGGPIVRKWMDLYFKNNLAKCPLSHLIMLAPANHGSALAQLGKSRLGRIKSFFEGIEPGKCVLDWLELGSDMSWQLNESWLDYDCTANGVYSFVLTGQKIDRQFYDAVNSYTGESGSDGVVRVAATNMNYSLLKLHQEGDNGESLVVAKMTRTQPMAFGVLPGLSHSGKNIGIIRSITMANAATHPTAIWILRCLQVKSRDSYNKLVKELDNITKETQKNEHKEFVKTLVFTREYITNRYSMIIFRLIDDRGNHLIDYDLYLTAGPQYSEQALPAGFFVDRQRNLNNRGKLTYFLDYDIMEGGINTPKMQGNLGFRVKAYPESSDQALAYYRLLDFHSSLADIHKILHPNETVMVEIMLQRRVDRTVFRISNNLTPAKISGKPTGKKID
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: plaB mutant is attenuated in guinea pigs (Schunder et al., 2010).
References
Schunder et al., 2010: Schunder E, Adam P, Higa F, Remer KA, Lorenz U, Bender J, Schulz T, Flieger A, Steinert M, Heuner K. Phospholipase PlaB is a new virulence factor of Legionella pneumophila. International journal of medical microbiology : IJMM. 2010; 300(5); 313-323. [PubMed: 20153694].