Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

dotA from Legionella pneumophila str. Corby

Victor ID 1834
Gene Name dotA from Legionella pneumophila str. Corby
Sequence Strain (Species/Organism) Legionella pneumophila str. Corby
NCBI Gene ID 5182249
NCBI Protein GI 148358578
Locus Tag LPC_0450
Protein Accession YP_001249785.1
Other Database IDs UniProtKB-ID: A5IAN9_LEGPC
UniRef100: UniRef100_A5IAN9
UniRef90: UniRef90_A5IAN9
UniRef50: UniRef50_Q5ZS33
UniParc: UPI0001527D4C
EMBL: CP000675
EMBL-CDS: ABQ54439.1
RefSeq_NT: NC_009494.2
GenomeReviews: CP000675_GR
KEGG: lpc:LPC_0450
eggNOG: NOG41268
HOGENOM: HBG520268
OMA: LQASERI
ProtClustDB: CLSK833557
BioCyc: LPNE400673:LPC_0450-MONOMER
Taxonomy ID 400673
Gene Starting Position 480277
Gene Ending Position 483339
Gene Strand (Orientation) +
Protein Name defect in organelle trafficking protein DotA
DNA Sequence
>gi|148358139:480277-483339 Legionella pneumophila str. Corby, complete genome
AATGAATAAATTAGCTATTACGGTCCTCCTTTGCTTTTTTCCTGCGCTTGCACTGGCTGAAAGTGGCGCC
TTAAGTTTCGCGCCTCCGGCAAGCGATTTGTCCGTTGTTTTTTTAGGTAACCTGTTTGGTGTAGTCGATG
GGGTCTTGCACGGAACGGGAAGCCAGATAATGGGCAACATGTTTGGTGTCTTCAACTCCGCTGTCCTTGC
TTTGGGTGGAATCATCATTATGTATACCCTCATGGTTTCCACCATGAACACCGCTCATGAAGGGCAAATG
CTTGGCCAAAAATGGTCCTCTATCTGGATTCCTCTTCGTTCCACTTTCGGTTTGGCTTTGTTAATACCTA
AAGCATCCGGTTATTGTATGATGCAGGTATTTTTTATGTGGGTTATTGTGCAAGGTGTTGGTGCAGCTGA
TAAAATATGGGAAGCTGCCTTGAGTTATCTGAATCGGGGTGGTGTGATAATACAGGCTCAGTCTGATCCA
ACCAAGAGCCTCACAGATCAGGATGGGATGTCTACAGGTATAGCAAATGGGGCATTTACTATATTGTCTG
GTCAAGTCTGCATGTTGGGTTTGCAAAAACAATTACAGGCACAAAGAGATCTTTATTTGAGTCAAAGTAA
GAGTCCACCTTGTGGGGGTAATCCTACTCCTGAAATGAATACTTTTTGCCGCACAGCGATTCCTGATTTC
ATCAGTACAGTCAATTTTGTCAAGAAGCAAAGCGATAGCAAGCCTGAAGGACCATTTAGCCTTGATATGC
CAAACTTCGATGATCGCTCACCATTTTATTTCTTAAATGGGATTTGTGGCACAGTAAAATGGAATAGTAT
TTCTGGTTTGCAGGCTGATATGGGAAAAGGCATAAATCTTAATTCTTCGGAATTGAAAACAGCCCAATTG
TCTCGCGCGATTGCTATACAGCAAATGTACGTGACTTTATCAACGGTAGCCCAGGTGATGGTTAATAATG
ATCCCGCTTTTTCAACAACCTCATCTACCGGAAATTCAAAAAATGATTTTTCCGATATTGCCAAACAACA
GTTTGGGGTGCCTTATAAAGCATCTGGTCAGCCCTGCGACAAATATAGTGATGTTTGCCAAACATGGGGG
GCAACAACCAGTTCCTCAGGATCTACTGCGGGGGTATTGTTTAATGGCACGGAATTTTTAGGGGCGATCA
ATGACTACAATGGCATTATGACGCCGACTGTTAATCTTTTAAAGCAAAAAGCTAATTTAGCAGACGATGA
CTCATCCCGTAAGTTTATTGCAGAAGCCAATGCCAAAGGGTGGATCATGGCTGGCTCTTATTTTTTTGAT
TTGGTCAAACTCAATGGAAGTGCAGTAAAAGACGTGAGTGATTTTGATAAGGACACAGGCCTTGATAATA
GTAATTTTGATCCAGAACAACTCACCAAGCCATTTGGGAAAACATGTCAGGGCACTCGTTCTTTATTGTG
CACCTGGTTTCAAAACAAGAGCGATAAGCTGGTTCAAATCCAGTCCCTAATCAATGGCGTTCCTGCCTTG
AGTCAAGATGGGGTCAAGCAACCTGATCTAAAGCCTGATACTGGACGTGAAGCTGTGGAAGGATCATTGT
CTTCAACAGTTTATGGCTTTGTCAACAATTCCATGATGGTCCAGTTGCCCGGCCAGCCGGGAATAAAACC
GTTGACCTTTGCCAATCTTATTAATTTTAAAGTGGATACTTCGCTTTATTACATGAAGCACCAGGATTTT
GATTGCGGCAGGGTGAAGATTTTGTTCTTCTCGTTTTGCCTTGGCCGCATGATGGGTGATTTATTTTATA
ACTATGTTTTCAGGTACGTGTACAATTTCTTTCTAGCTATATTCGGGGAAATGATTAATTCCATAGTTAT
GGCCTTTTTAATGATTCCTTTACAAGGTATGAAAGATATTTTCATAGTGGGCGTTCAAACTCTTACGAAG
CCTGGAGTAAACCCCATTGTCGCATTGGCTAATATGGGAACGATGTATATTAATTTTTCTGGTACTTTGT
GGTTAACACTGTTGAATATGGCGGTGGTCAGTTCACTAATCCCACTTTTTGGTATCTTTATCTTTGCCTT
GATTATGATGGCTATGCCTTTGTTGATGGCATGGATAGGGACCATGGTGTCCATAGGATTTGTTACAGCA
TATTATATACCTGTTTTACCTTATATGATTTTTACTTTTGGATCATTTGCCTGGCTGATAGCCGTTATCG
AGGCTATGGTGGCTGCACCTATTGTTGCCTTGGGTGTTACGCATCCAGAAGGTAATGAGGCTTTTGGTAA
AGGTGAATTTGCCATTATGATTTTGGTTAATGTCTTTTTAAGACCTTCTCTGATGATAATAGGATATATT
GCAGCGATTGCCTTGTCTTATGTTGGCGTGTGGATTTTGAATGCCGGATTTGATCATGCCATTTCCTACA
TCCAATCGGATCAAGGAATAGAAACATGGGAAAAAGGCACCAGTTCAAATGATGCGAAGAGGTTTTTCCA
GAGCGCCGGGAACTGGACTGGAGCAAAGATGGATACATCGCAATGGGATAATTTTAAGGATAAGTTGACA
GGTGATTATCAATCAACTGCATTAGAAGGTGGGTATACAGGCTGGGCAGGAGTGTATGCTTTCTTCTTCT
CCATCTTAATTTATACCAGTATGTATTTAATTATTGTACAAAAAGCCTTTACACTGATTGCTCACCTGCC
AGATAAAGTGCTGAGATGGATAGGTGGTAGTCCGGAATCTTTTGGTCAAGAAACAATGCAATGGGGTGAG
GAAGCCAAAGGTAGAGTAGAGAAAGCAGGCGAAGCTACTTATGGGGCTGAGAAAGCTATTGGTGACAAAT
TGGGGGCTAAAGGGCAAGAGATGCTTGGCAAATTGGGGCCTCAAGCTAAAAAGATTTCGGAAAATGCGGG
TGATGTTTCAGGGAAAGGTAAAAACAGTGGCAGCCAGACTGGGCCAAGCTCGAAACCGGATACAGGCCAA
CAACTGGGCGGTTCAGATAGTGGCCCCCCAACTAGTACCCCACCTCCTGAATA
Protein Sequence
>gi|148358578|ref|YP_001249785.1| organelle trafficking lipoprotein defect DotA [Legionella pneumophila str. Corby] MNKLAITVLLCFFPALALAESGALSFAPPASDLSVVFLGNLFGVVDGVLHGTGSQIMGNMFGVFNSAVLALGGIIIMYTLMVSTMNTAHEGQMLGQKWSSIWIPLRSTFGLALLIPKASGYCMMQVFFMWVIVQGVGAADKIWEAALSYLNRGGVIIQAQSDPTKSLTDQDGMSTGIANGAFTILSGQVCMLGLQKQLQAQRDLYLSQSKSPPCGGNPTPEMNTFCRTAIPDFISTVNFVKKQSDSKPEGPFSLDMPNFDDRSPFYFLNGICGTVKWNSISGLQADMGKGINLNSSELKTAQLSRAIAIQQMYVTLSTVAQVMVNNDPAFSTTSSTGNSKNDFSDIAKQQFGVPYKASGQPCDKYSDVCQTWGATTSSSGSTAGVLFNGTEFLGAINDYNGIMTPTVNLLKQKANLADDDSSRKFIAEANAKGWIMAGSYFFDLVKLNGSAVKDVSDFDKDTGLDNSNFDPEQLTKPFGKTCQGTRSLLCTWFQNKSDKLVQIQSLINGVPALSQDGVKQPDLKPDTGREAVEGSLSSTVYGFVNNSMMVQLPGQPGIKPLTFANLINFKVDTSLYYMKHQDFDCGRVKILFFSFCLGRMMGDLFYNYVFRYVYNFFLAIFGEMINSIVMAFLMIPLQGMKDIFIVGVQTLTKPGVNPIVALANMGTMYINFSGTLWLTLLNMAVVSSLIPLFGIFIFALIMMAMPLLMAWIGTMVSIGFVTAYYIPVLPYMIFTFGSFAWLIAVIEAMVAAPIVALGVTHPEGNEAFGKGEFAIMILVNVFLRPSLMIIGYIAAIALSYVGVWILNAGFDHAISYIQSDQGIETWEKGTSSNDAKRFFQSAGNWTGAKMDTSQWDNFKDKLTGDYQSTALEGGYTGWAGVYAFFFSILIYTSMYLIIVQKAFTLIAHLPDKVLRWIGGSPESFGQETMQWGEEAKGRVEKAGEATYGAEKAIGDKLGAKGQEMLGKLGPQAKKISENAGDVSGKGKNSGSQTGPSSKPDTGQQLGGSDSGPPTSTPPPE
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: dotA mutant is unable to replicate in mouse macrophages (Vincent et al., 2006).
References
Vincent et al., 2006: Vincent CD, Buscher BA, Friedman JR, Williams LA, Bardill P, Vogel JP. Identification of non-dot/icm suppressors of the Legionella pneumophila DeltadotL lethality phenotype. Journal of bacteriology. 2006; 188(23); 8231-8243. [PubMed: 16997951].