Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

feoB from Legionella pneumophila str. Corby

Victor ID 1836
Gene Name feoB from Legionella pneumophila str. Corby
Sequence Strain (Species/Organism) Legionella pneumophila str. Corby
NCBI Gene ID 5182279
NCBI Protein GI 148358608
Locus Tag LPC_0482
Protein Accession YP_001249815.1
Other Database IDs UniProtKB-ID: A5IAR9_LEGPC
UniRef100: UniRef100_A5IAR9
UniRef90: UniRef90_Q5X1N2
UniRef50: UniRef50_Q5WTE1
UniParc: UPI0001527E74
EMBL: CP000675
EMBL-CDS: ABQ54469.1
RefSeq_NT: NC_009494.2
GenomeReviews: CP000675_GR
KEGG: lpc:LPC_0482
eggNOG: COG0370
HOGENOM: HBG731320
OMA: AMMYLMF
ProtClustDB: CLSK833536
BioCyc: LPNE400673:LPC_0482-MONOMER
Taxonomy ID 400673
Gene Starting Position 511429
Gene Ending Position 513684
Gene Strand (Orientation) +
Protein Name ferrous iron transporter B
DNA Sequence
>gi|148358139:511429-513684 Legionella pneumophila str. Corby, complete genome
TATGACTCATGCCCTATTAATAGGAAATCCCAATTGTGGTAAGACAACCCTATTCAATGCCTTGACCAAT
GCGAATCAACGCGTAGGCAACTGGCCCGGAGTAACTGTTGAGAAAAAAACAGGTGAATTTTTGCTTGGAG
AACATTTAATTGAAATCACTGATTTGCCAGGTGTCTATTCTCTGGTTGCGAATGCCGAAGGAATAAGCCA
GGATGAGCAAATTGCTGCTCAGTCAGTTATTGATTTGGAATACGATTGCATCATTAATGTTATAGATGCT
TGTCACCTTGAAAGACATTTGTATTTAACCAGCCAACTTTTTGAGTTAGGTAAACCTGTTGTTGTAGCAC
TTAACATGATGGATATTGCCGAGCAGCGGGGTATTTCTATTGATACAGAGAAACTCGAGAGTTTGTTAGG
ATGTTCGGTTATTCCCATTCAGGCCCATAAAAACATTGGTATTCCGGCACTTCAGCAATCATTGCTTCAT
TGCTCCCAAAAGATAAAACCTCTAAAACTTTCCTTATCAGTTGTTGCACAACAAGTTCTGGATGACCTGG
AAAATCAGTTGATCTCAAAAGGGTATAAAAATTCCTTTGCCTACTATTTCTCCCGTAGGCTTGCCGAAGG
GGATACTTTGATAGGAGAGAAAGCTTTTACCGAGAGTCTTCTTATAAAGCTTCAAGAAACGGAGCAAAAT
CTTGATGTGTTACTGGCAGACGCTCGCTATCAAAAAATCCATGAAATTGTTACGTTGGTTCAAAAAAAGC
ATAGTGATGCCAGCGAACACTTCACTGCGAAATTGGATAAACTTGTTTTGCATCGCTTTTTAGCTTTGCC
CATATTTTTTGCGATGATGTATTTAATGTTTTTGTTTGCTATTAATATTGGGGGAGCATTCCAGGATTTT
TTTGACATTAGTACAGAGACTATCTTTGTTCAGGGTAGTGGTTGGTTGTTGCAACAGCTCCATGCACCAA
ATTGGGTAATCGCGCTTGTAGCTAATGGGGTAGGCAAAGGAATTAATACCACTATTACTTTTATTCCTGT
GATTGCCGCGATGTTTTTCTTTTTGTCCTTATTGGAAACTTCTGGCTATATGGCAAGAGCTGCTTTTGTC
GTGGATAAAGCGATGCGAGCCATGGGATTACCAGGAAAATCATTTGTACCTATGATTGTGGGTTTTGGAT
GTAATGTCCCTGCCATTATGGCAGCACGCACCCTGGATTCGGAGCGCGATCGATTATTAACTGTGATGAT
GAGTCCATTTATGTCTTGTAGTGCCCGACTGGCTATTTATGCGGTATTTGTCGCGGCTTTTTTCCCCTCT
GGCGGGCATAATATTGTTTTTTCGTTGTATTTGATTGGCATTTTAATGGCCGTATTTACCGGATATATTT
TACGCAAAACTACGTTGAAGGGACATGCTTCTCCTTTGATTTTGGAGTTACCCGCTTATCATAGACCCTC
ACTCAGAAGATTGCTGAGAGAAACCTCCATGCGATTACGATTTTTTGTTTATCGTGCGGGTAAGCTGATT
ATTCCCATTTGTGTGATTCTGGGAGGATTAAATGCGATTACTTGGGGAGGAGGGATTAGCTCCGGAGAAG
CAAATACGGATTCTTTATTGTCAATAATAGGTCAGTGGATTACTCCATTATTTGCTCCAATGGGAATTCA
TCAAGACAACTGGCCCGCGACCGTCGGTTTATTAACTGGCATGCTGGCTAAAGAGGTAGTGGTTGGCACC
TTAAACTCACTTTATGCCCAAGTAGGTCATGTGGGAGAAATAGCTGCTGCCCACTTTGATTTTTGGGGGG
GCATCAAAGCTGCTTTTGGGTCTATTCCCGCCAATTTGTCTGAATTAGGCTCTGCATTGTGGAACCCTGT
TTCTGCCAGTGCAGCTGATAGTGAGTTATCTCAATCTGTCTATGGCATTATGTCACGACGTTTTGATGGA
GCTGTAGGAGCCTACGCTTATTTGCTTTTTGTTTTGCTTTATATCCCTTGTGTTTCGACTATGGCAGTGA
TTCGCCAGGAGGCAAACAAGCGATTTATGTGGACTTCCATTGTTTGGTCATTTGTCGTGGCTTACACCAC
TTCCGTTGTCTTTTATCAAGGCGCTACATTTCTGGATCATCCTCAACAAAGTATGATCTGGATTTTGGCT
ATGTCACTGAGCCTGCTTTTTGTTTTAGCTGTATTTCGTTATAGCCAGTATGGTATGGGGAGGCAAAATG
CTGCTGCAAATACGTG
Protein Sequence
>gi|148358608|ref|YP_001249815.1| ferrous iron transporter B [Legionella pneumophila str. Corby] MTHALLIGNPNCGKTTLFNALTNANQRVGNWPGVTVEKKTGEFLLGEHLIEITDLPGVYSLVANAEGISQDEQIAAQSVIDLEYDCIINVIDACHLERHLYLTSQLFELGKPVVVALNMMDIAEQRGISIDTEKLESLLGCSVIPIQAHKNIGIPALQQSLLHCSQKIKPLKLSLSVVAQQVLDDLENQLISKGYKNSFAYYFSRRLAEGDTLIGEKAFTESLLIKLQETEQNLDVLLADARYQKIHEIVTLVQKKHSDASEHFTAKLDKLVLHRFLALPIFFAMMYLMFLFAINIGGAFQDFFDISTETIFVQGSGWLLQQLHAPNWVIALVANGVGKGINTTITFIPVIAAMFFFLSLLETSGYMARAAFVVDKAMRAMGLPGKSFVPMIVGFGCNVPAIMAARTLDSERDRLLTVMMSPFMSCSARLAIYAVFVAAFFPSGGHNIVFSLYLIGILMAVFTGYILRKTTLKGHASPLILELPAYHRPSLRRLLRETSMRLRFFVYRAGKLIIPICVILGGLNAITWGGGISSGEANTDSLLSIIGQWITPLFAPMGIHQDNWPATVGLLTGMLAKEVVVGTLNSLYAQVGHVGEIAAAHFDFWGGIKAAFGSIPANLSELGSALWNPVSASAADSELSQSVYGIMSRRFDGAVGAYAYLLFVLLYIPCVSTMAVIRQEANKRFMWTSIVWSFVVAYTTSVVFYQGATFLDHPQQSMIWILAMSLSLLFVLAVFRYSQYGMGRQNAAANT
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: feoB mutant is attenuated in human macrophages (Robey and Cianciotto, 2002).
COG COG0370P, under P: Inorganic ion transport and metabolism
References
Robey and Cianciotto, 2002: Robey M, Cianciotto NP. Legionella pneumophila feoAB promotes ferrous iron uptake and intracellular infection. Infection and immunity. 2002; 70(10); 5659-5669. [PubMed: 12228295].