Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

lvgA from Legionella pneumophila str. Corby

Victor ID 1837
Gene Name lvgA from Legionella pneumophila str. Corby
Sequence Strain (Species/Organism) Legionella pneumophila str. Corby
NCBI Gene ID 5182556
NCBI Protein GI 148360819
Locus Tag LPC_2777
Protein Accession YP_001252026.1
Other Database IDs UniProtKB-ID: A5IH30_LEGPC
UniRef100: UniRef100_A5IH30
UniRef90: UniRef90_Q9RNG8
UniRef50: UniRef50_C6N5R8
UniParc: UPI000152786B
EMBL: CP000675
EMBL-CDS: ABQ56680.1
RefSeq_NT: NC_009494.2
GenomeReviews: CP000675_GR
KEGG: lpc:LPC_2777
HOGENOM: HBG520054
OMA: AFESIIN
ProtClustDB: CLSK832234
BioCyc: LPNE400673:LPC_2777-MONOMER
Taxonomy ID 400673
Gene Starting Position 3036697
Gene Ending Position 3037323
Gene Strand (Orientation) -
Protein Name hypothetical virulence protein
DNA Sequence
>gi|148358139:3036697-3037323 Legionella pneumophila str. Corby, complete genome
TTTATTTTCGTGCAGTAGTTGCAGAAGATACCGGATGCTTATAATTTTCTCTTGGGGATTCAGGAGGATA
ACCATACCCTTTATCCGCCAGGCGTTTCACATTTTGTAAATATTTTTCACCCCATATTCCGGGATCAAAA
TTAGTCACAACAACATTATAAGGTAAATTAATAATTGACTCAAAAGCCTTTCTCTGGGCTATTTCATGGC
CAGCAAAAGCTATCTGAACCTCTTCCTCCATACTGACACCGCCAGATTTTAAGCGATCTACCAGAATATG
AACCATTTTTTCAATAGTATAAAAAAGTTTGCACATAGACATGCCCGCACTAAACATATCCTGGCTTTTG
GATGTAGATAATTTAGAGCCACTATCATGAATGGAATAAACAAATTCATGCTCATTAGAACCAGATATCA
GTTCGGGTTCGATGACTATCGCAGGAGTAATAGTATCAATATGTGGAGAAATAACATGAAGATGAAAATC
TGCCCAATGCCACCATATCAGATAGACTCGCTCCACTATCGCTAATGGATTATTCAAATCATCTATCATT
GTCAGTTTGCGATCGTCTAGATCAGTATCTACGAAACCTGCTTTGATTTCGATATCGCCGTCTGCCA
Protein Sequence
>gi|148360819|ref|YP_001252026.1| hypothetical protein LPC_2777 [Legionella pneumophila str. Corby] MADGDIEIKAGFVDTDLDDRKLTMIDDLNNPLAIVERVYLIWWHWADFHLHVISPHIDTITPAIVIEPELISGSNEHEFVYSIHDSGSKLSTSKSQDMFSAGMSMCKLFYTIEKMVHILVDRLKSGGVSMEEEVQIAFAGHEIAQRKAFESIINLPYNVVVTNFDPGIWGEKYLQNVKRLADKGYGYPPESPRENYKHPVSSATTARK
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: lvgA mutant is attenuated in guinea pigs (Edelstein et al., 2003).
References
Edelstein et al., 2003: Edelstein PH, Hu B, Higa F, Edelstein MA. lvgA, a novel Legionella pneumophila virulence factor. Infection and immunity. 2003; 71(5); 2394-2403. [PubMed: 12704109].