Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

icmB from Legionella pneumophila str. Corby

Victor ID 1838
Gene Name icmB from Legionella pneumophila str. Corby
Sequence Strain (Species/Organism) Legionella pneumophila str. Corby
NCBI Gene ID 5182665
NCBI Protein GI 148360927
Locus Tag LPC_2887
Protein Accession YP_001252134.1
Other Database IDs UniProtKB-ID: A5IHD8_LEGPC
UniRef100: UniRef100_A5IHD8
UniRef90: UniRef90_Q5ZYB6
UniRef50: UniRef50_A5IHD8
UniParc: UPI000035A73A
EMBL: CP000675
EMBL-CDS: ABQ56788.1
RefSeq_NT: NC_009494.2
GenomeReviews: CP000675_GR
KEGG: lpc:LPC_2887
eggNOG: NOG47700
HOGENOM: HBG376707
OMA: ELWAFST
ProtClustDB: CLSK861735
BioCyc: LPNE400673:LPC_2887-MONOMER
Taxonomy ID 400673
Gene Starting Position 3146116
Gene Ending Position 3149145
Gene Strand (Orientation) -
Protein Name IcmB (DotO)
DNA Sequence
>gi|148358139:3146116-3149145 Legionella pneumophila str. Corby, complete genome
TTCAACCTACTTTTGCAGGCAAGCTTTTAACGTTGGGATCTTTTGAATAAGCATCAAGAATATCATTCAC
CAATTGGTTAATCATTCCCTCTCTCTCATCGTCTTCAATTAACCCAACTTTTTGCTTCATGCTTGCTAAT
CGAGCCTCCAATTCTTTAGTCACTGTACCATTTGGGAACAGTGCAGCTAAAAGCCGTCGAGCTTCACTTG
GTCCCAGATGCCTATACAAAAGATTTCGTACTGTGGCATCTTCTGCAGTAGTACTAAATGCCCATAATTC
CACCGGCCCCAATGTTAAGGTTAATAATTGTACGTTGATACCTGTTTTAGTAGCAAACTGAGCAAGGAAA
GTAGCGCCACCTTGTCTAGGACCATGAACTCGAGTACGTAACGCAATCTTGGCTGTTTCAGAAAGTCCAA
AAATTTGACTGGTCTTCTCGACAGCTTGAGATGGTCCTGCATCCATAACATAAATAGCGGTAGCAAAATC
AATCATTACCGGATCAAAGTCATCTACTGCTTGTGATAATAAGGAAATTTGCACTTTCCATTTTCGGCCT
TCACGCATATCAATAATAACCTGCTCACGAACAGCAGACGATTTTGCCGTGCGATGGAATTCATCATAAA
CAATACGCTTATGATCTTCTCGAATCTCTAATACTCTCTGTTTGTGATACTCTTTATATTGTTCCGGTAC
ATTATTCAAACTTTCTTCTGTTAAATAATAGTGCCTTGCCAATACATATCTGGCTAACATATACATAACC
GCTGTTTGTCTATCTGCAGCATCACCACCACTTTTCGCTACTTCATCCAAATCAAGAGACACTACTCTTG
CGTCACCAATATCAAAACTAGTGACCCGTGATAAAATAGGATATTCGCGAACAGCCGATGAAATCATTCT
TGAAAAAGCATTAATTAGTGATTCGCCAGTTGGAGCTGTAATCTTTTCATACAAATCCTCAATTGATGGT
GTTCTACAGATAGAAGCAGCATCCGCTAATAACGGCATTGCATATCTTTGCGCTAACATCGCTTCATGGA
CAAAACCTGCTGAATAGAGCGAGTCAGTCACTTCCCACCAGGTTGATTTGGCATCTCGGACAAAACCTAT
TTCCTCCAGGATGCTATCGATAAATTCCTCTATTCCTGGAGCATAAGGAGTCGGATTGAATTCATCAGCC
ATGCTTTTATATAATTCATCTACCACCATACCCGCCAAATCGGCCATACCGTCATATGGCTTTGCAGCAC
CTAATGGCGTAGTTAGCAAGGTCATGAAGTTGACTAAGAATGATCGTTCCAAAGCAGTTGGATAACGACA
TCCCAATTGGGTATCAAAGGGATTAATGGAATAATCTGGGGTCATCCTTAATCTATGATAAGCAACCAAA
TGACGTTTGGATGCAGGAAGAGCCTCTTTTAGCAATGAAATCAAACCACTACTTGAGGGACCTATATCAA
TAATTGCAATGCGCGGCAAACGCATTAAACCACCTGAAAGACAAAGAGCTAAATTCAGTGCATTTGACAA
CACAGATTTACCAGAACCAGGACGAGCGTAAACCAGATCAATCCAGGTAGTTTGTTCAGTTGAGCCTGGT
TGAAATGGCCACGGTTTACCATCTGGTGTTCTAAAAAGCAAGGCTCCTGTTTTCCAGGGAGATGCTGGTC
TTGTAATAGGCAGCATTGAGATAACGTCTGACAAAGGAGCTACTGAGGCTACTGCTGAGCTGTTCAAAGT
AGTAGCTAGCATACTTGACACAAAGCCTGCAAATGGATCCCCACAAATCTCTGATACATCAGTAGAACCC
CAACCTTCAATAGCCTTTACTAACTCAGAACTTCTTCGCCGCAACAAGGGAATATTGCCTTCAGGGGCCC
AAGTTGTTGCAACGACACGAAGCCTGACAATCGCCTCATCTGTATTGAGTTGTATATATTTCAACAGATT
GACCGAGTCACTAATTAAACGATTTTGTGCAGAACTAAAGCTCAATATAGCAGCCAAGAGCCCCTTTAAT
TTAATTGTGCTTAATCCTTCGCTTTCTAGCAAAAAAGAAATTTTCCAGGGCACATGTGAAGGAAGAATAC
GGGAAAATAAACTAATAAATGGTCTTACGTCCTTTGGAAACAAATCAATATAGGTTGAAGAATAAATTTT
ATCCCCTACTCGGACAGTGCGTAAATCAATAATCTCTGCATCTCTTGGCAAAACCTGCTTGGACAACGGC
GGCCATAATAAATCAGAAGGATCTCCCTCAAAATTATTCAGTTCGCGAACAGGTATTTTGTCTCCAGGTA
AAGTTGCCCGCCAATCATCTGCAGTATAATCAGGATCACCTGTCATGCGAATGGCATGTATAGCATCATG
AACCTCAAGCAACTTAGCTATCACATTAAGGGCATCCAAATCATTTAGAATTGCACGCACATAAGCATCA
TGTGTATCTCTTATTTCCGGAACAGCCGCAAAAATCGTTTGTGTGTTTTTAAAGGGAGGAGCCTTTGTAT
CCTTGATCATCTTCATTTTTGCTTTGTTCGCAGCTTTTAACTGATCGCTCGCTAAATTAAATGGTCTCGT
ATACAAAACAAAATAAACACGCTCCTCTGCACAATATTGTGATAAATAATTGACCCTCTCCTCAAATAAA
TCTCTTAAATTAAGTTCAAGACGACTTGCTGTTGCTTCCGCAGGGTCATAAATATCCTTGATCATTTTTA
CTATGTTTTGCTTATCATGGCTAAAATAAACTTGTAGCGCATGACCAGGTCTACCCATAGCAGCTTGAAA
TGAGTTGGCTAAACCTTCAACGAGTCGTTCAAACTCTTCAGGGCCTGCCAATCCAGTAATCCCTTCAATT
TTTAATACTGACAGTAATGAGCCATCATGATTAACTAATACGGTAGGGCTATCTGCCGTTTCCAAATCTA
TATAAGACTCTGTAGTTTGCTTCAGGGAAGTACTTAACCAGGCAAAGAAAGTATCGACGCCTTCAAAAAA
CGATTCTGACCAATTTGCCA
Protein Sequence
>gi|148360927|ref|YP_001252134.1| hypothetical protein LPC_2887 [Legionella pneumophila str. Corby] MANWSESFFEGVDTFFAWLSTSLKQTTESYIDLETADSPTVLVNHDGSLLSVLKIEGITGLAGPEEFERLVEGLANSFQAAMGRPGHALQVYFSHDKQNIVKMIKDIYDPAEATASRLELNLRDLFEERVNYLSQYCAEERVYFVLYTRPFNLASDQLKAANKAKMKMIKDTKAPPFKNTQTIFAAVPEIRDTHDAYVRAILNDLDALNVIAKLLEVHDAIHAIRMTGDPDYTADDWRATLPGDKIPVRELNNFEGDPSDLLWPPLSKQVLPRDAEIIDLRTVRVGDKIYSSTYIDLFPKDVRPFISLFSRILPSHVPWKISFLLESEGLSTIKLKGLLAAILSFSSAQNRLISDSVNLLKYIQLNTDEAIVRLRVVATTWAPEGNIPLLRRRSSELVKAIEGWGSTDVSEICGDPFAGFVSSMLATTLNSSAVASVAPLSDVISMLPITRPASPWKTGALLFRTPDGKPWPFQPGSTEQTTWIDLVYARPGSGKSVLSNALNLALCLSGGLMRLPRIAIIDIGPSSSGLISLLKEALPASKRHLVAYHRLRMTPDYSINPFDTQLGCRYPTALERSFLVNFMTLLTTPLGAAKPYDGMADLAGMVVDELYKSMADEFNPTPYAPGIEEFIDSILEEIGFVRDAKSTWWEVTDSLYSAGFVHEAMLAQRYAMPLLADAASICRTPSIEDLYEKITAPTGESLINAFSRMISSAVREYPILSRVTSFDIGDARVVSLDLDEVAKSGGDAADRQTAVMYMLARYVLARHYYLTEESLNNVPEQYKEYHKQRVLEIREDHKRIVYDEFHRTAKSSAVREQVIIDMREGRKWKVQISLLSQAVDDFDPVMIDFATAIYVMDAGPSQAVEKTSQIFGLSETAKIALRTRVHGPRQGGATFLAQFATKTGINVQLLTLTLGPVELWAFSTTAEDATVRNLLYRHLGPSEARRLLAALFPNGTVTKELEARLASMKQKVGLIEDDEREGMINQLVNDILDAYSKDPNVKSLPAKVG
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: icmB mutant is attenuated in guinea pigs (Edelstein et al., 1999).
References
Edelstein et al., 1999: Edelstein PH, Edelstein MA, Higa F, Falkow S. Discovery of virulence genes of Legionella pneumophila by using signature tagged mutagenesis in a guinea pig pneumonia model. Proceedings of the National Academy of Sciences of the United States of America. 1999; 96(14); 8190-8195. [PubMed: 10393970].