Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

ptsP from Legionella pneumophila str. Corby

Victor ID 1841
Gene Name ptsP from Legionella pneumophila str. Corby
Sequence Strain (Species/Organism) Legionella pneumophila str. Corby
NCBI Gene ID 5182932
NCBI Protein GI 148361183
Locus Tag LPC_3157
Protein Accession YP_001252390.1
Other Database IDs UniProtKB-ID: A5II44_LEGPC
UniRef100: UniRef100_A5II44
UniRef90: UniRef90_A5II44
UniRef50: UniRef50_A1TYU3
UniParc: UPI00000BD9B6
EMBL: CP000675
EMBL-CDS: ABQ57044.1
RefSeq_NT: NC_009494.2
GenomeReviews: CP000675_GR
KEGG: lpc:LPC_3157
eggNOG: COG3605
HOGENOM: HBG456539
OMA: LGHRLMR
ProtClustDB: CLSK914860
BioCyc: LPNE400673:LPC_3157-MONOMER
Taxonomy ID 400673
Gene Starting Position 3415847
Gene Ending Position 3418141
Gene Strand (Orientation) -
Protein Name phosphoenolpyruvate protein phosphotransferase PtsP
DNA Sequence
>gi|148358139:3415847-3418141 Legionella pneumophila str. Corby, complete genome
ATCATGACTTTCCTGCTCTGATTAATCCTCCTAATCCTTCCTCTTCTAGGGCCTTTTGCAAATGAAATCG
TATTTCAGCAGGATGTTCAAATTCCAAAACTTCTGCCAGAATTTTACGGGCATTCGCGATAGCAAAATTG
CGAATAACCCATTTCACCCTGGGTAAACTGGCGGAATTCATACTTAAGGTGTCAAAACCCATAGCAATTA
ACAAGATCACCGCTAAAGGATCGCTGGCCATTTCGCCACAAATACTCACCTCAACACCAGCCGCATGCCC
TCCTTCCACTATTTTAAGCAATGTACGTAACATGGCTGGATGCAAGGGATCATAAAGTGCGGCAACTCGG
GCGTTATTTCTATCCACAGCTAATAAATATTGAGTAAGATCATTACTACCTACCGAAATAAAATCCACTC
GTTTCGCCATTTCTCTTGCCAGATAAGCAGCGGCAGGCACTTCAATCATCACACCAATTTTGGGTTTTAC
TATTTCGCACCCCTCTTCCACCAGCTCTTCAAATGCCTGTTCAATCAAATAAACGGCTTCTTCTACTTCG
CTAAGTGTAGTGACCATAGGCAACATGATACGTAAATTATCCAGTTCCTCACTGGCACGCATCATGGCAC
GAACCTGAATCAGGAAGACATCTGGATGATCAAGAGTTATCCTTATTCCACGCCATCCTAAATAAGGGTT
TTCCTCTTCAACTGGAAAATAAGGTAGAATTTTGTCGCCACCAATATCCAGTGTACGCATAGTCACCAAA
CGTGGAGCAAAGGCCTTGAGGGTCTGTCTGTAAATAATGGTCTGCTCATCTTCTGAAGGGAATCGATCTC
GACTCATAAATGGTACTTCTGAACGGTATAAACCAACTCCTTCAGCGCCAACACTCATTGATAAACCGGC
ATCCATTGCCAAGCCGGTATTGACTTGCAAAGAGACTCTGTAGTTATCAGTAGTTTCAGCTGGTTTATCA
CGCAAGCTTACCAGGCTTTGGTTTAATTCCTGTTCCTCTTGAGCTAATTGCTTAAATTCCGCTAATAATG
ATTTGGAAGGAGAAATATAAACATGCCCATAATAGCCATCAACAATCAAAGCCCGGCGCGATACCAATTC
TACTTTTAATCCTCTCAATCCCATCACAGTAGGTACACCGAGAGCTCTCGCTAAAATAGCAACATGGGAG
TTATTGGAGCCTTTAGCTGAAACGACACCAGCCAATTGCCCTTCTGGAACTTCTGCCAGAGCGGCAGCAG
TAATTTCTTCTCCTATTAAAATGGTTCTCTTTGGATAAACAATTTCTTCTCTTTGGGTACGTTGTAATTC
CGCCAAAACTCTTCGGCCCAAGTCACGGAAATCGCTGGCTCGTTCGCGTAGATAATCATCACCCATGCTT
TCAAATTGCTGCACGTGTTTCTTGATCACTGTAGCCAAGGCAGCTTGAGCGCTGATTTTCTCTTCACGAA
TCACATGCTCTACTTCAGCACCCAAGCTATCCCTATCCAAAATTCTTAAATACACATCGAATAAAGCATG
CTCTTCCTCAGCAACCGTTTCTTTCATGCGTTTACTTAAACGCCTGATATCATCTCTTGTCGTTTCCAAA
GCTTCATAAAACGCATTGATTTCATCTTCCAATTCTTCCACTGGATTACGAGGGACAGCATCAATATCCG
CAGGCGGGTACACAACCACGGCAGTACCAATTCCTATACCAGGAACACTGCCTATTCCAGTCAGTGCAGT
ATAAGCCGCTTCTACCTTGTCGACTCCTATACCCTTTTTAGGTTGTGTTAACTCGGCCAATTCACCTGTT
GCCTCTGCATGAGCAATAATCCCGCCTAATTGAGCCGCCAAGGTAATAAGAAATGATTCTTCAGCATCAT
CAAAATGACGTTGTTCAAGCTGTTGTACAACTAAAACACCGTATAATTTTCTATGTTGAATAATAGGGAC
GCCCAAAAAAGCGTTCAGGTGATCTTCGCCAATTAATGGGTTATGATAAAAATCCGGATGAGAGGGAGCA
TTTTCTATATTGATAGGTTCCTCTCTTCGTCCTATCAACCCGATAAGGCCGCAATCAAGAGCAATTCTGA
CTCTAAACTCTGCCTGCTTGTTCAAACCTTCCGTGGCTATCAATACGTATTCAGCATTTTTATTATCAAT
AAGATAAACGGAAACAGCCTCTGCATTAATGGCTGTATTAATACGTTGCACCAAAATACCAAGTGCTTCT
TTCAAATCACTGGCAGCGGTAACATCTTGTACTATCCGTTTAAGTATTTTAAGCA
Protein Sequence
>gi|148361183|ref|YP_001252390.1| phosphoenolpyruvate protein phosphotransferase PtsP [Legionella pneumophila str. Corby] MLKILKRIVQDVTAASDLKEALGILVQRINTAINAEAVSVYLIDNKNAEYVLIATEGLNKQAEFRVRIALDCGLIGLIGRREEPINIENAPSHPDFYHNPLIGEDHLNAFLGVPIIQHRKLYGVLVVQQLEQRHFDDAEESFLITLAAQLGGIIAHAEATGELAELTQPKKGIGVDKVEAAYTALTGIGSVPGIGIGTAVVVYPPADIDAVPRNPVEELEDEINAFYEALETTRDDIRRLSKRMKETVAEEEHALFDVYLRILDRDSLGAEVEHVIREEKISAQAALATVIKKHVQQFESMGDDYLRERASDFRDLGRRVLAELQRTQREEIVYPKRTILIGEEITAAALAEVPEGQLAGVVSAKGSNNSHVAILARALGVPTVMGLRGLKVELVSRRALIVDGYYGHVYISPSKSLLAEFKQLAQEEQELNQSLVSLRDKPAETTDNYRVSLQVNTGLAMDAGLSMSVGAEGVGLYRSEVPFMSRDRFPSEDEQTIIYRQTLKAFAPRLVTMRTLDIGGDKILPYFPVEEENPYLGWRGIRITLDHPDVFLIQVRAMMRASEELDNLRIMLPMVTTLSEVEEAVYLIEQAFEELVEEGCEIVKPKIGVMIEVPAAAYLAREMAKRVDFISVGSNDLTQYLLAVDRNNARVAALYDPLHPAMLRTLLKIVEGGHAAGVEVSICGEMASDPLAVILLIAMGFDTLSMNSASLPRVKWVIRNFAIANARKILAEVLEFEHPAEIRFHLQKALEEEGLGGLIRAGKS
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: ptsP mutant is attenuated in guinea pigs (Higa and Edelstein, 2001).
COG COG3605T, under T: Signal transduction mechanisms
References
Higa and Edelstein, 2001: Higa F, Edelstein PH. Potential virulence role of the Legionella pneumophila ptsP ortholog. Infection and immunity. 2001; 69(8); 4782-4789. [PubMed: 11447151].