Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

RVFVsSgp1

Victor ID 1917
Gene Name RVFVsSgp1
Sequence Strain (Species/Organism) Rift Valley fever virus
NCBI Gene ID 956561
NCBI Protein GI 9632366
Locus Tag RVFVsSgp1
Protein Accession NP_049343.1
Taxonomy ID 11588
Segment No segment S
Gene Starting Position 34
Gene Ending Position 831
Gene Strand (Orientation) +
Protein Name NS protein
DNA Sequence
>gi|9632365:34-831 Rift Valley fever virus segment S, complete sequence
CATGGATTACTTTCCTGTGATATCTGTTGATTTGCAGAGTGGTCGTCGTGTTGTGTCAGTGGAGTACTTT
AGAGGAGATGGTCCTCCCAGGATACCTTATTCTATGGTTGGGCCCTGTTGTGTCTTTCTCATGCACCATC
GTCCTAGTCACGAGGTTCGCTTGCGATTCTCTGACTTCTACAATGTCGGAGAATTCCCATACCGAGTCGG
ACTTGGAGACTTTGCATCAAACGTTGCACCTCCACCAGCGAAGCCTTTTCAGAGACTTATTGATCTAATA
GGCCATATGACTCTTAGTGATTTCACAAGGTTCCCCAATCTGAAAGAAGCCATATCCTGGCCTCTTGGAG
AACCCTCACTGGCTTTCTTCGACCTAAGCTCTACTAGAGTGCATAGGAATGATGACATTAGAAGGGATCA
GATTGCCACTCTAGCAATGAGGAGTTGCAAGATCACCAATGATCTAGAGGACTCCTTTGCTGGCTTACAC
AGGATGATAGCGACTGAGGCCATCCTCAGAGGGATTGACCTGTGCCTGTTGCCAGGCTTTGATCTCATGT
ATGAGGTTGCTCACGTACAGTGCGTTCGGCTTCTGCAAGCAGCAAAAGAGGACATTTCTAATGCTGTAGT
TCCAAACTCAGCCCTCATTGTTCTTATGGAGGAGAGCCTGATGCTGCGCTCATCACTTCCCAGCATGATG
GGGAGAAACAACTGGATTCCAGTTATTCCTCCAATCCCAGATGTTGAGATGGAATCAGAGGAGGAGAGTG
ATGATGATGGATTTGTTGAGGTTGATTA
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: NSs mutant virus is avirulent in mice (Le et al., 2008).
References
Le et al., 2008: Le May N, Mansuroglu Z, L├ęger P, Josse T, Blot G, Billecocq A, Flick R, Jacob Y, Bonnefoy E, Bouloy M. A SAP30 complex inhibits IFN-beta expression in Rift Valley fever virus infected cells. PLoS pathogens. 2008; 4(1); e13. [PubMed: 18225953].