Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

VP4

Victor ID 3032
Gene Name VP4
Sequence Strain (Species/Organism) Rotavirus
NCBI Gene ID 3773132
NCBI Protein GI 81097462
Locus Tag HRCV_s3gp1
Protein Accession YP_392514.1
Other Database IDs UniProtKB-ID: VP4_ROTHC
UniRef100: UniRef100_Q82040
UniRef90: UniRef90_Q82040
UniRef50: UniRef50_Q82040
UniParc: UPI00000F1928
EMBL: X79442
EMBL-CDS: CAA55958.1
RefSeq_NT: NC_007572.1
Taxonomy ID 36427
Segment No 3
Gene Starting Position 20
Gene Ending Position 2254
Gene Strand (Orientation) +
Protein Name outer capsid spike protein
DNA Sequence
>gi|81097461:20-2254 Rotavirus C segment 3, complete sequence
GATGGCGTCTTCACTGTACGCACAATTAATCTCACAAAATTACTATTCTCTAGGAAATGAAATTTTATCT
GATCAACAAACTAATAAAGTGGTATCAGACTATGTGGATGCAGGAAACTACACCTATGCTCAATTGCCAC
CTACAACGTGGGGATCTGGGTCAATACTTAAATCGGCATTCTCTACACCTGAAATAACTGGACCACATAC
GAATACAGTAATTGAATGGAGTAACTTAATAAATACTAATACTTGGCTGTTATATCAGAAACCATTAAAT
TCAGTTAGATTATTAAAGCATGGTCCAGACACTTATAACAGCAATCTAGCAGCATTTGAGCTATGGTATG
GAAAATCTGGAACTACTATAACATCCGTATATTATAACACTATCAATAACCAAAATAAGACGCATGATGC
TAATTCAGATTGTTTAATTTTATTTTGGAACGAGGGATCTACACAGTTAGAAAAACAAGTCGTAACATTC
AACTGGAACGTGGGTGGTATACTAATTAAACCAATAAATTCAAGTAGAATGAGAATTTGCATGTCAGGAA
TGGAAAATTTTAATAATGATTCATTTAATTGGGAAAATTGGAATCACGAGTTTCCAAGAAGTAATCCTGG
TATTAATATTAATATGTATACTGAGTATTTTCTGGCAAGTAGTGATCCATATACATATCTTAAAAATTTA
CAACAGCCAACAGCTAAAACTGTAGACATGAAAATGATGAAAAAGATGAATGATAACTCAAAATTAGGGG
ATGGTCCTATTAATGTTAGTAATATTATTAGTAAGGACTCATTGTGGCAAGAAGTTCAATACGTACGTGA
TATAACTTTGCAATGTAAAATATTATCTGAAATTGTGAAAGGTGGAGGATGGGGATATGACTATACTAGT
GTAACGTTTAAAACAGTTAATCATACATATTCATACACTAGAGCAGGAGAAAATGTTAATGCTCATGTGA
CTATAAGTTTCAATAATGTAAAAGAACGAGCATATGGAGGATCACTGCCTACTGATTTTAAAATTGGTAG
ATTTGATATACTCGATACTGATTCATATGTATATATTGATTATTGGGATGATTCAGAAATATTTAAAAAT
ATGGTATATGTTCGCGATGTACGAGCGGATATAGGAGGATTTCAGTATTCTTATTCGTCAGAGATGTCAT
ATTATTTTCAGATACCTGTAGGATCATATCCTGGATTACATTCATCAAGGTTGCAACTTGTTTATGATAG
ATGTTTATTATCTCAACAATTTACTGATTATGCAGCTTTGAATTCGTTAAGATTCGTATTCAGAGTAGTT
TCGACTAGTGGATGGTTCATTACAACAGGAGATATAAATACTAGAAGAGTAGCATCAGGGACAGGATTTG
CTTATTCAGACGGTCATGTAGCTAATACAGTTGGAACTATTTCATTTATTTCTTTAATACCAAGTAATCC
GAACTACCAAACTCCAATAGCTTCATCTAGTACTGTAAGAATGGATTTAGAGAGAAAAATCAATGATTTA
CGTGATGACTTCAATGCTTTAGCGAGTTCAGTTGCATTAAGTGATATACTTTCCCTCGCTATGTCACCAT
TAACATTTTCTAATCTATTAGAATCAGTTCCGGCTATTACTTCATCGGTTAAGGATGTTGCTGCTAGTGT
TATGAAAAAATTTAGAAGTACTAAAATGTTCAAAAAAGCAGCAAAACAAAATTATCGGGAGTTTGTCATT
GGAGACTTATTGGAAGACGTTACTAATGTTGCTAGGAATAATAATTCGTTGAACTATAGTGATATTACTT
CGGCCATGATGGTTTCAACTACTAACAGATTACAAATTACTGATGTAGATACTTTTTCAGAAATAGTATC
ACGATCAGCTGACAATTTTATTTCAAATAGATCTTATAGAATGATAGAAAATAATACTGTTCATGAAATA
ACGCCTACAAGAAGATTTTCATATGACATTAAAACCTTACAGCAACGAAATTTCGACATAGATAAATTCT
CTAAACTAGCTTCTCAATCTCCCGTTATATCTGCAATAGTTGATTTTGCTACCATAAAAGCAATACGTGA
TACTTATGGCATTAGTGATGATATCATATACAAATTAGTGGCATCTGACGCTCCTACTATTTTGTCATTT
ATTAATCAGAATAATCCACTCATACGGAATAGAATTACTAATCTAATAAATCAATGCAAATTGTA
Protein Sequence
>gi|81097462|ref|YP_392514.1| outer capsid spike protein [Rotavirus C] MASSLYAQLISQNYYSLGNEILSDQQTNKVVSDYVDAGNYTYAQLPPTTWGSGSILKSAFSTPEITGPHTNTVIEWSNLINTNTWLLYQKPLNSVRLLKHGPDTYNSNLAAFELWYGKSGTTITSVYYNTINNQNKTHDANSDCLILFWNEGSTQLEKQVVTFNWNVGGILIKPINSSRMRICMSGMENFNNDSFNWENWNHEFPRSNPGININMYTEYFLASSDPYTYLKNLQQPTAKTVDMKMMKKMNDNSKLGDGPINVSNIISKDSLWQEVQYVRDITLQCKILSEIVKGGGWGYDYTSVTFKTVNHTYSYTRAGENVNAHVTISFNNVKERAYGGSLPTDFKIGRFDILDTDSYVYIDYWDDSEIFKNMVYVRDVRADIGGFQYSYSSEMSYYFQIPVGSYPGLHSSRLQLVYDRCLLSQQFTDYAALNSLRFVFRVVSTSGWFITTGDINTRRVASGTGFAYSDGHVANTVGTISFISLIPSNPNYQTPIASSSTVRMDLERKINDLRDDFNALASSVALSDILSLAMSPLTFSNLLESVPAITSSVKDVAASVMKKFRSTKMFKKAAKQNYREFVIGDLLEDVTNVARNNNSLNYSDITSAMMVSTTNRLQITDVDTFSEIVSRSADNFISNRSYRMIENNTVHEITPTRRFSYDIKTLQQRNFDIDKFSKLASQSPVISAIVDFATIKAIRDTYGISDDIIYKLVASDAPTILSFINQNNPLIRNRITNLINQCKL
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: Reassortant viruses with the RRV VP4 entered cultured mouse cholangiocytes more efficiently than did those with UK VP4 (Feng et al., 2010).
References
Feng et al., 2010: Feng N, Sen A, Wolf M, Vo P, Hoshino Y, Greenberg HB. The roles of VP4 and NSP1 in determining the distinctive replication capacities of simian rotavirus RRV and bovine rotavirus UK in the mouse biliary tract. Journal of virology. 2010; ; . [PubMed: 21191030].