Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

toxA from Pseudomonas aeruginosa PAO1

Victor ID 4206
Gene Name toxA from Pseudomonas aeruginosa PAO1
Sequence Strain (Species/Organism) Pseudomonas aeruginosa PAO1
NCBI Gene ID 877850
NCBI Protein GI 15596345
Locus Tag PA1148
Protein Accession NP_249839.1
Other Database IDs UniProtKB-ID: TOXA_PSEAE
UniRef100: UniRef100_P11439
UniRef90: UniRef90_P11439
UniRef50: UniRef50_P11439
UniParc: UPI0000137188
EMBL: K01397
EMBL: AE004091
EMBL-CDS: AAB59097.1
EMBL-CDS: AAG04537.1
RefSeq_NT: NC_002516.2
PDB: 1AER
PDB: 1DMA
PDB: 1IKP
PDB: 1IKQ
PDB: 1XK9
PDB: 1ZM2
PDB: 1ZM3
PDB: 1ZM4
PDB: 1ZM9
PDB: 2ZIT
PDB: 3B78
PDB: 3B82
PDB: 3B8H
TCDB: 1.C.73.1.1
GenomeReviews: AE004091_GR
KEGG: pae:PA1148
NMPDR: fig|208964.1.peg.1149
PseudoCAP: PA1148
HOGENOM: HBG639690
OMA: AHESNEM
ProtClust
Taxonomy ID 208964
Gene Starting Position 1240583
Gene Ending Position 1242499
Gene Strand (Orientation) -
Protein Name exotoxin A
DNA Sequence
>gi|110645304:1240583-1242499 Pseudomonas aeruginosa PAO1 chromosome, complete genome
GTTACTTCAGGTCCTCGCGCGGCGGTTTGCCGGGCTGGCTGGCGTAGTCCGGCAGGGCGCTGATCGCCTG
TTCCTTGTCGGGGATGCTGGACGGGTCGAGGTCGCCGCCGACGTTGCGCGGGTCGGTGGGGATCGCCGAG
GGAATCACCACGGTGCGCTCGGCCAGCGGCCAGCCGAGAATGGTCTCCAGGCGCCCGCCTTCCTCCTCGG
GGCCGGTGATGGCGTCCAGGCGCAGCGGCAGCGGATGGCCGATCAGCCGTTCGACCTCGCCCGCCGCCTC
CGGCGCGGCCAGGGTCAGGCCGGTGCGGTAGAAGCCCGGCAGACTCGAGCGCGGCACATAGACCCGCAGC
AGGGCACCGTTGCGGATCCGGCCGCGCGCGTCGGGTTCCTGGTCCTGGGCGTAGCCGTAGGCCAGCGCCG
GATCGCCGGCGATATAGAAACCGCGCCAGATCGCGTCGAGGTCCTGGCTGCGCGCGCGCACCCCGCCGAA
GACGATGCTTTGCGCCGCTTCGAGGAAGGTGCCGTGGTAGCCGACGAACACATAGCCGCGCTCCTCCAGT
TGGCGGTGCGCCTGGAGCAGCCGCTCCACCGTCCAGTTCTGCGTGCCGCGGGTGCTGAAGCTGATGTCGC
CGCCGTCGCCGAGGAACTCCGCGCCAGTGGGATAGTTGCGCTCCAGCAGGGCGTCGCCGCTGTCCGCCGG
GCCCGCGCATTCACCGGCGGCGACCGGGCAGGTCAGGCTCACCACGTCGGCGCTGGCCGCGCCGGCCTCG
TCGTTGCCTGTGCCCTGCCGGACGAAGCGCTCGCTCTCGGCGGCGGCCAGGGTCAGGGCCAGACGGGCCT
GCTCCGGCTGCTCGCGGATCGCTTCGCCCAGGTCGCCGCCGCTGCCGGGGCTGGCCAGGGCGTTGCGGAT
CACCTGGTCGACCTGGTTCCACGACAGCCGCGCCGCCAGGTAGAGGGCGACCAGCCGCTGCACCGGATAG
CCGCACTGCTCCAGTTGTTCCCAGCCGCGCGGCTGGCGATGACGGGTGAAGGTCTCCAGCGGCAGGTGGC
AGGCCTGGTGCGCGGTCAGCGCGGCCAGGCTGCCGCCCTCGGGGAAATGCAGGCGATGACTGATGACCGT
GGGCTTGATGTCCAGGTCATGCTTCGCCGGGTTGCCGGCGAGCACCCGGTAGATCTTGCCTTCCCAGGTA
TCGTCGAGGTTGCAGCGCTGCTGGGCGAGGTAGTTGTAGACCCCGTCCAGCGGGTCGAGCAGGCACAACA
CCTTGCCGCTGGCCCATTCGCTCCAGCGCTTTTCCCGGCGCGGCTGGGCCTGGGCCATGACCACGCTGAC
CCCGGCATGGCTGATGGCGAGCGTCGGCTGCATCTCGTTGCTCTCGTGCGCCCTGACGAAGAAGGTGGCA
TCGCGCGCCAGCTTCGCCAGCAACTCGTCGCCCATCTCGATGGTGTAGATCGGCGACATGTGGCTGAGCT
GGTTACCGGCGTTCAGTTCGTGGATGAACACCTTGATGTTCGAAGGCTTCTCGTGGCCGATCGGCACCAG
CCAGTTCAGCGACCAACTGCCGCGCGCCTGGCGCGTGTAGCTGTAGCGCACCGGCTTGTTCGGCTCGACG
CCACCTTCGAGGCGGATGGTCAGGCCGTCGCTGGTGATGCTGAGGGCGTTGTCGATGGCCAGCTTGAGCG
CGTCGTTGCCGCCCTCCAGGACCATGGAGTAGTGCAGCACGCCCTGGCCGTTGGTGTCGGCGATGGCCGG
GTCGACGCTCATGCGGCTGGAACGCACGCCGTCCTTGAGGTCGAGCACGCAGGCCTTGGCGCATTCGTTC
CAGAGGTCGAAGGCTTCCTCGGCGGCGGACGCGAACGAGCCGCCGGCGAGCAGGCCGAGGCTGGCGACCA
GGGGGATCCAATGGGGTGTCAGGTGCA
Protein Sequence
>gi|15596345|ref|NP_249839.1| exotoxin A [Pseudomonas aeruginosa PAO1] MHLTPHWIPLVASLGLLAGGSFASAAEEAFDLWNECAKACVLDLKDGVRSSRMSVDPAIADTNGQGVLHYSMVLEGGNDALKLAIDNALSITSDGLTIRLEGGVEPNKPVRYSYTRQARGSWSLNWLVPIGHEKPSNIKVFIHELNAGNQLSHMSPIYTIEMGDELLAKLARDATFFVRAHESNEMQPTLAISHAGVSVVMAQAQPRREKRWSEWASGKVLCLLDPLDGVYNYLAQQRCNLDDTWEGKIYRVLAGNPAKHDLDIKPTVISHRLHFPEGGSLAALTAHQACHLPLETFTRHRQPRGWEQLEQCGYPVQRLVALYLAARLSWNQVDQVIRNALASPGSGGDLGEAIREQPEQARLALTLAAAESERFVRQGTGNDEAGAASADVVSLTCPVAAGECAGPADSGDALLERNYPTGAEFLGDGGDISFSTRGTQNWTVERLLQAHRQLEERGYVFVGYHGTFLEAAQSIVFGGVRARSQDLDAIWRGFYIAGDPALAYGYAQDQEPDARGRIRNGALLRVYVPRSSLPGFYRTGLTLAAPEAAGEVERLIGHPLPLRLDAITGPEEEGGRLETILGWPLAERTVVIPSAIPTDPRNVGGDLDPSSIPDKEQAISALPDYASQPGKPPREDLK
Molecule Role Virulence factor
Molecule Role Annotation TOXIN: toxA (exotoxin A) blocks protein synthesis by ADP ribosylation of elongation factor 2, thereby triggering cell death (Morlon-Guyot et al., 2009).
References
Morlon-Guyot et al., 2009: Morlon-Guyot J, Méré J, Bonhoure A, Beaumelle B. Processing of Pseudomonas aeruginosa exotoxin A is dispensable for cell intoxication. Infection and immunity. 2009; 77(7); 3090-3099. [PubMed: 19380469].