Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

PA5437

Victor ID 4209
Gene Name PA5437
Sequence Strain (Species/Organism) Pseudomonas aeruginosa
NCBI Gene ID 877878
NCBI Protein GI 15600630
Locus Tag PA5437
Protein Accession NP_254124.1
Other Database IDs UniProtKB-ID: Q9HTC9_PSEAE
UniRef100: UniRef100_B7V5X8
UniRef90: UniRef90_B7V5X8
UniRef50: UniRef50_Q4K3G6
UniParc: UPI00000C6006
EMBL: AE004091
EMBL-CDS: AAG08822.1
RefSeq_NT: NC_002516.2
GenomeReviews: AE004091_GR
KEGG: pae:PA5437
PseudoCAP: PA5437
HOGENOM: HBG685425
OMA: NEVCDLR
ProtClustDB: CLSK869350
BioCyc: PAER208964:PA5437-MONOMER
Taxonomy ID 208964
Gene Starting Position 6119960
Gene Ending Position 6120895
Gene Strand (Orientation) +
Protein Name putative transcriptional regulator
DNA Sequence
>gi|110645304:6119960-6120895 Pseudomonas aeruginosa PAO1 chromosome, complete genome
GATGCGTATGACATTACGGCAGCTTCAGGTTTTCCGTGCCGTATGCGAGAGCCGCTCCTACAGCCGGGCG
GCGGAGGAAATGGCCTTGACCCAGCCGGCGGTCAGCCTGCAGATCCGCCAACTGGAAGAGCTGGTCGGCC
AGCCGCTGTTCGAGTACGTCGGCAAGAAGCTCTACCTGACCGATGCCGCCGAAGCCCTGCTGAAGACCAG
CACCGACCTGTTCCAGCGCCTGGAAAGCCTGGACATGCAGCTCTCGGATCTGAAGGGCTCGCTGCAGGGC
CAGTTGCGCCTGGCGGTGGAGTCCAGCGCCAAGTACATCACCCCGCACCTGTTCAAGGCGTTCCAGAACC
TGCATCCGGAAGTCAGCCTGAGCCTGACGGTGGTCAACCGCACCCAGGTGATCAAGCGCTTGGCCGACAA
CCGCGACGACCTGGTGATCATGTCCCTGGTACCGCAGGACATGGCCCTGGAGTTCCTGCCCTTCCTGAAC
AACCCGATCATCGCCGTGGCGCCGCCGGACCATCCGCTGTGCAACGCCGCGAAGCTGGCCCTGAAGGACC
TGGAGCCCTTCCCGCTGCTGGTCCGCGAACCGGGCTCGGGCACCCGCAAGGCTTGCGAGGAGTTCTTCCA
GCAACGCCGCGCGCACTTCTCGCAGATCCAGGAGATCGCCTCGCTGGAGTCCCTGCGTGAAGGGGTGATC
GCCGGCCTCGGCCTGGCCCTGCTGCCGCGCCATGCGGCGCACCAGGAACTGGCCAACGGCCTGCTGCGCG
AACTACCGGTGGAGGAATTGCCGCTCTATCGCAGCTGGTGCCTGGTGCACGCCAAGGGCAAGCGCCTGAG
CCCGGTGGCCCAGGCGTTCGTCGCCTTCGTCCGCGAGGAGCGGGCGCTGATCAGCCAGCTCGCTGGGCGC
TTCGCCGGCCCTGGCGGTTCGAGCTG
Protein Sequence
>gi|15600630|ref|NP_254124.1| transcriptional regulator [Pseudomonas aeruginosa PAO1] MRMTLRQLQVFRAVCESRSYSRAAEEMALTQPAVSLQIRQLEELVGQPLFEYVGKKLYLTDAAEALLKTSTDLFQRLESLDMQLSDLKGSLQGQLRLAVESSAKYITPHLFKAFQNLHPEVSLSLTVVNRTQVIKRLADNRDDLVIMSLVPQDMALEFLPFLNNPIIAVAPPDHPLCNAAKLALKDLEPFPLLVREPGSGTRKACEEFFQQRRAHFSQIQEIASLESLREGVIAGLGLALLPRHAAHQELANGLLRELPVEELPLYRSWCLVHAKGKRLSPVAQAFVAFVREERALISQLAGRFAGPGGSS
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: PA5437 mutant is attenuated in rats (Potvin et al., 2003).
COG COG0583K, under K: Transcription
References
Potvin et al., 2003: Potvin E, Lehoux DE, Kukavica-Ibrulj I, Richard KL, Sanschagrin F, Lau GW, Levesque RC. In vivo functional genomics of Pseudomonas aeruginosa for high-throughput screening of new virulence factors and antibacterial targets. Environmental microbiology. 2003; 5(12); 1294-1308. [PubMed: 14641575].