Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

PA0151

Victor ID 4210
Gene Name PA0151
Sequence Strain (Species/Organism) Pseudomonas aeruginosa PAO1
NCBI Gene ID 877893
NCBI Protein GI 15595349
Locus Tag PA0151
Protein Accession NP_248841.1
Other Database IDs UniProtKB-ID: Q9I6Y1_PSEAE
UniRef100: UniRef100_Q9I6Y1
UniRef90: UniRef90_B7V268
UniRef50: UniRef50_A1UUV1
UniParc: UPI00000C4F66
EMBL: AE004091
EMBL-CDS: AAG03541.1
RefSeq_NT: NC_002516.2
GenomeReviews: AE004091_GR
KEGG: pae:PA0151
NMPDR: fig|208964.1.peg.151
PseudoCAP: PA0151
HOGENOM: HBG542811
OMA: VGDETIA
ProtClustDB: CLSK865635
BioCyc: PAER208964:PA0151-MONOMER
Taxonomy ID 208964
Gene Starting Position 171046
Gene Ending Position 173433
Gene Strand (Orientation) +
Protein Name putative TonB-dependent receptor
DNA Sequence
>gi|110645304:171046-173433 Pseudomonas aeruginosa PAO1 chromosome, complete genome
CATGACCCCGTTCCCGCGCTTCGCCCTGCGTACTCTCCCCGCCCTGTTCCTCAGCCTCGGCTGTCTCGCC
GCCACCGTGCAGGCCGCCGAGGCGGTTCGCTACCGCTTCAGCCAGGCTGCCGCGCCGCTGGCCCAGGCGC
TCAACGCGTTCAGCCGGGCCAGCGGGCAGACGCTGCTCTACACCGCCGAGCTGCCGCCGCAGGCGACCGC
TCCGGCATTGCACGGTTCGCTGGTCGCGGAGGAGGCGCTGCAACGCCTGCTGCAGGGCAGCGGCCTGCGC
GCGCGGCGGATCGACGAGCGCACCCTGACCCTGGAACCGATCCCCGCCAGCGGCGCGCTCGACCTCGATG
CCACGACGGTCTCCGCCGCCGCCCCGGCGCAGGGCTACCGGCCGGCGGCCAACGCCTCGATCAGCCGCGG
CGATGCGCCGGTACTGGAAATCCCCCAGGCGATCAGCGTGGTCCCGGCACAGGCGCTGCAGGACCAGCGC
CCGCGCAACCTTGACGACGCGCTGGGCAACATCAGCGGCATCACCCAGGCCAACACCCTCGGCGGTACCC
AGGACGCGGTGATGAAGCGCGGCTTCGGCGACAACCGCGACGGCTCGATCATGCGCGACGGCATGCCCTC
GGTGCAGGGCCGCAATTTCACCGCCACCGCCGACCACGTCGAGGTGCTGAAGGGGCCAGCATCCCTGCTC
TATGGCATCCAGGATCCGGGCGGGGTGGTCAACGTGGTGAGCAAGAAGCCACAACTGCAACAAGCCAACG
CCCTGACCCTGCGTGGCTCGGCCTACGCCCACGGGCGCAACGGCAGCGGCGGCCAGCTCGACTCCACCGG
CCCGCTGGGCGACAGCGGACTGGCCTACCGGATGATCCTCGATCATGAGGACGAGGATTACTGGCGCGAC
TTCGGCAAGAGTCGCGAGACGCTGGTGGCGCCCTCGCTGGCCTGGTACGGCGAGGACACGACGGTCAACC
TGAGCTACGAGCACCGCGAGTTCACCACGCCGTTCGACCGTGGTACGGCCATCGACCCGCGTACCAACCG
CCCGCTGGACATCCCGCGCAGCCGGCGCCTGGACGAGCCCTTCAACATCACCGAGGGCCGTTCCGAGCTG
ACCCGCCTGGATCTCGAACGGCAGCTCGACGACACCTGGAAGGCCCACTTCGGCTACGGCTACAGTCGCG
AGACCTACGACGACAACCAGGCCCGGGTGATGGCCGTGAATGCCGACGGCACCCTGACCCGGCGCATGGA
CGGCACCCACGGCGCGGTCAGCAGCGACAGCTTCACCACCCTCGGCCTGAGCGGAACGCTGCAACTGGCC
GGGATGCAACATGACCTGCAATTCGGCATGGACCACGAGAAGCGCAAGATCTTCCGCGCCGACCTGCTGC
GCGACAGCAAGACCAGCCGCTTCGACTACCTCGACCCGGTCTATGGCCAGGTGGTGCCGTCGACCCGGGT
GGTCGCCGGCGACAGCGACCAGACCGACAAGCTGCGCAGCGACTCGCTGTACTTCCAGGACTCGATCCAC
CTGGACGAACGCTGGATCCTGGTCGGCGGCGCGCGCTACCAGATCTACGACCAGCTCGCCGGGCGCGGCC
GGCCGTTCAACGCCAACACCGATATCAACGGGCAGAAATGGGTGCCGCGCGGCGGCCTGGTCTACCGCCT
GAGCGACGAGGTTTCGCTGTACGGCAGCTACATGCGCTCGTTCAAGCCGAACTCGACCATCGCCCCGCTG
AGCACCGGCGAGACCATCGATTCGGCGATCCTGCCGGAGGAGGCGACCTCCTGGGAGCTGGGCGCCAAGC
TGGATGTGCCGGGGCGTCTCAGCGGCACCCTGGCGCTGTTCGACATTCGCAAGAAGAACGTGCTGGTCAA
CGAACTCGACGGTGCCGGCAACAGCAGCGTGCGCGCCGCCGGCCGGGTCCGCTCGCGCGGCCTGGAGCTG
GACCTCACCGGCCAGCTCAGCGAACGCTGGAGCCTGATCGGCAGCTACGCCTGGCTCGCCGCGGAAGTCA
CCGAGGACCCGACCCTGGAGGGCAAGCGCCTGCAGAACGTGGCGCGCAACACCGCGTCGCTGTCGGCGGT
CTACGAACTCGGCCAGCTCTTCGGCGGCGACCGCCTGCGCCTGGGCGGCGGCGCGCGCTACGTCGGCAAG
CGCCCGGGCGACCCGGCCAATTCCTTCGACCTGCCGTCCTACACCGTGGCCGATGCCTTCGCCAGCTACG
ACACCCGCTTCGGCGGGCACGGCGTGAAGTTCCAGCTCAACGTGAAGAACCTGTTCGACCGCACCTACTA
CCCGTCCAGTGCCAATCGACTGTACGTGGCGATGGGCGAGCCCCGGCAGTTCCAGGTGTCGACGACGGTG
GAGTTCTG
Protein Sequence
>gi|15595349|ref|NP_248841.1| TonB-dependent receptor [Pseudomonas aeruginosa PAO1] MTPFPRFALRTLPALFLSLGCLAATVQAAEAVRYRFSQAAAPLAQALNAFSRASGQTLLYTAELPPQATAPALHGSLVAEEALQRLLQGSGLRARRIDERTLTLEPIPASGALDLDATTVSAAAPAQGYRPAANASISRGDAPVLEIPQAISVVPAQALQDQRPRNLDDALGNISGITQANTLGGTQDAVMKRGFGDNRDGSIMRDGMPSVQGRNFTATADHVEVLKGPASLLYGIQDPGGVVNVVSKKPQLQQANALTLRGSAYAHGRNGSGGQLDSTGPLGDSGLAYRMILDHEDEDYWRDFGKSRETLVAPSLAWYGEDTTVNLSYEHREFTTPFDRGTAIDPRTNRPLDIPRSRRLDEPFNITEGRSELTRLDLERQLDDTWKAHFGYGYSRETYDDNQARVMAVNADGTLTRRMDGTHGAVSSDSFTTLGLSGTLQLAGMQHDLQFGMDHEKRKIFRADLLRDSKTSRFDYLDPVYGQVVPSTRVVAGDSDQTDKLRSDSLYFQDSIHLDERWILVGGARYQIYDQLAGRGRPFNANTDINGQKWVPRGGLVYRLSDEVSLYGSYMRSFKPNSTIAPLSTGETIDSAILPEEATSWELGAKLDVPGRLSGTLALFDIRKKNVLVNELDGAGNSSVRAAGRVRSRGLELDLTGQLSERWSLIGSYAWLAAEVTEDPTLEGKRLQNVARNTASLSAVYELGQLFGGDRLRLGGGARYVGKRPGDPANSFDLPSYTVADAFASYDTRFGGHGVKFQLNVKNLFDRTYYPSSANRLYVAMGEPRQFQVSTTVEF
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: PA0151 mutant is attenuated in rats (Potvin et al., 2003).
COG COG1629P, under P: Inorganic ion transport and metabolism
References
Potvin et al., 2003: Potvin E, Lehoux DE, Kukavica-Ibrulj I, Richard KL, Sanschagrin F, Lau GW, Levesque RC. In vivo functional genomics of Pseudomonas aeruginosa for high-throughput screening of new virulence factors and antibacterial targets. Environmental microbiology. 2003; 5(12); 1294-1308. [PubMed: 14641575].