Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

PA0073

Victor ID 4220
Gene Name PA0073
Sequence Strain (Species/Organism) Pseudomonas aeruginosa PAO1
NCBI Gene ID 878396
NCBI Protein GI 15595271
Locus Tag PA0073
Protein Accession NP_248763.1
Other Database IDs UniProtKB-ID: Q9I759_PSEAE
UniRef100: UniRef100_B7V0V9
UniRef90: UniRef90_B7V0V9
UniRef50: UniRef50_Q4K3P8
UniParc: UPI00000C4F1A
EMBL: AE004091
EMBL-CDS: AAG03463.1
RefSeq_NT: NC_002516.2
GenomeReviews: AE004091_GR
KEGG: pae:PA0073
NMPDR: fig|208964.1.peg.73
PseudoCAP: PA0073
HOGENOM: HBG758042
OMA: RVMQLLV
ProtClustDB: CLSK865574
BioCyc: PAER208964:PA0073-MONOMER
Taxonomy ID 208964
Gene Starting Position 86283
Gene Ending Position 87002
Gene Strand (Orientation) -
Protein Name ABC transporter ATP-binding protein
DNA Sequence
>gi|110645304:86283-87002 Pseudomonas aeruginosa PAO1 chromosome, complete genome
ATCAGCCAACTTCCTCGAGGCAGGCGCCGACGCTGTCGTCGGCCTCGCGTTGCCAGCGGATGGCCAGGAC
TTCCAGGCCGGCGGCGCGAGCCAGGCGTTCGTCGTGGGTGGCGACCACGGTGCAGGCGCCGCGCTCGCGG
GCCTGCTCCACCAGCAGGCGCATCACCCGTTCGGCGTTCAGCGGGTCGAGCGCCGCGGTCGGCTCGTCGG
CCAGCAACAGGCGCGGCGCATGCGCCAGGGCGCGGGCGATGGCGACCCGCTGGCGCTGGCCGACCGATAG
CGCCGCCGGTTTCTTGTCCAGCTGGTCGCCGATTTCCAGCCGCTCGGCCAGCGCCTGTACGCGCTCGGCG
GATGGGGCGCCGAGCAACGCGCAGGGCAGTCCGATGTTGCGCCGCACATCGAGGAACTCGAGCAACCCGC
CGCTTTGCAGCACGTAGCCGCAGTGCTGCCGGCGCAGCGCCGCCAAGCGGTCCTGGCGGCCGTCGCGCCA
GAGCGCGGCGATGTCCTGCGGGCGTTCCCCGGCGAGGAATTCGAAGCGCCCGCCCGGGTCCGGCGCCAGG
GCCAGCGCCAGCAGGTCGAGCAGGGTGCTCTTGCCGCAGCCGCTGGGGCCGACGATGGCCAGCTGGCGAC
CCGCGCGCAATTCCAGCGCCGGCACCCGCAGGCGGTAGCGCTGGCGACCGGCGCCGTGGCTGCGGGCGAC
CTCGTGCAGGCGCAGGATCA
Protein Sequence
>gi|15595271|ref|NP_248763.1| ABC transporter ATP-binding protein [Pseudomonas aeruginosa PAO1] MILRLHEVARSHGAGRQRYRLRVPALELRAGRQLAIVGPSGCGKSTLLDLLALALAPDPGGRFEFLAGERPQDIAALWRDGRQDRLAALRRQHCGYVLQSGGLLEFLDVRRNIGLPCALLGAPSAERVQALAERLEIGDQLDKKPAALSVGQRQRVAIARALAHAPRLLLADEPTAALDPLNAERVMRLLVEQARERGACTVVATHDERLARAAGLEVLAIRWQREADDSVGACLEEVG
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: PA0073 mutant is attenuated in rats (Potvin et al., 2003).
COG COG1136V, under V: Defense mechanisms
References
Potvin et al., 2003: Potvin E, Lehoux DE, Kukavica-Ibrulj I, Richard KL, Sanschagrin F, Lau GW, Levesque RC. In vivo functional genomics of Pseudomonas aeruginosa for high-throughput screening of new virulence factors and antibacterial targets. Environmental microbiology. 2003; 5(12); 1294-1308. [PubMed: 14641575].