Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

PA0041

Victor ID 4221
Gene Name PA0041
Sequence Strain (Species/Organism) Pseudomonas aeruginosa PAO1
NCBI Gene ID 878601
NCBI Protein GI 15595239
Locus Tag PA0041
Protein Accession NP_248731.1
Other Database IDs UniProtKB-ID: Q9I791_PSEAE
UniRef100: UniRef100_Q9I791
UniRef90: UniRef90_A6UXA5
UniRef50: UniRef50_A6V502
UniParc: UPI00000C4EFB
EMBL: AE004091
EMBL-CDS: AAG03431.1
RefSeq_NT: NC_002516.2
GenomeReviews: AE004091_GR
KEGG: pae:PA0041
NMPDR: fig|208964.1.peg.41
PseudoCAP: PA0041
HOGENOM: HBG638663
OMA: AANDSNY
ProtClustDB: CLSK865550
BioCyc: PAER208964:PA0041-MONOMER
Taxonomy ID 208964
Gene Starting Position 42913
Gene Ending Position 53520
Gene Strand (Orientation) +
Protein Name hemagglutinin
DNA Sequence
>gi|110645304:42913-53520 Pseudomonas aeruginosa PAO1 chromosome, complete genome
TATGGACATCCGCAGCCCGCTGAACCAGTGCATCGCCCTGTCCCTGGCCGGCATCTTGTTCCTCAACCCG
ATCGTCGCCGCGGCGGCGGGGCTGGCGCTGGACAAGGCCGCCGGCGGCAACACCGGCCTGGGCCAGGCGG
GCAACGGCGTGCCCATCGTCAATATCGCCACGCCCAACGACGCCGGGCTGTCGAACAACCATTTCCGCGA
CTACAACGTCGGCGCCAACGGGCTGATCCTCAACAACGCTACCGGCAAGACCCAGGGTACCCAGCTCGGC
GGGATCATCCTCGGCAACCCCAACCTCAAGGGCCAGGCGGCGCAGGTGATCCTCAACCAGGTCACCGGCG
GCAACCGCAGCACCCTGGCCGGCTACACCGAGGTGGCCGGGCAGTCGGCGCGGGTGATCGTCGCCAACCC
GCACGGCATCACCTGCCAGGGCTGCGGCTTCATCAACACGCCGCGCGCGACCCTCACCACCGGCAAGCCG
ATCATGGACGGCCAGCGCCTGGAGCGCTTCCAGGTGGACGGCGGCGACATCGTCGTCGAAGGCGCCGAAC
TGAACGTCGGCAACCTCGAACAGTTCGACCTGATCACCCGCAGCGCCAAGCTCAACGCCAAGCTCTACGC
GAAGAACCTCAACATCGTCACCGGCCGCAACGACGTCCAGGCCGACAGCCTGCAGGCCACGCCGCGCGCC
GCCGATGGCAGCGAGAAGCCGCAGCTGGCGATCGACAGCTCGGCGCTGGGCGGGATGTACGCCGGGGCGA
TCCGCCTGGTCGGCACCGAGCAGGGCGTGGGGGTGCGGCTGGCCGGCGACATGGCCGCCAGCGGCGGCGA
CATCCGCATCGACGCCAGCGGCAAGCTGAGTCTGGCCCAGGCCTCCAGCCAGGGCGACCTGAAGATCGCG
GCCCAGGCCGTGGAGCTGAATGGCAAGACCTACGCCGGCGGCAGCGCCGAGATCCGCAGCGCGGAGGAAC
TGGTCAACCGGCAGAGCCTGGCGGCGCGCGAACGCATCGTGCTGGAGGCGGCGCATATCGACAACGCCGG
GGTGATCGAAGCCGGCGTCGAGCCAGACGAGCGACGCAACGCGCGCGGCGACCTCGAGCTGCGCAGCGGC
ACCCTGCGCAACGCCGGCAGCCTGGTGGCCAGCCGCGCGCTGGAAGCGAAGGCGAGCCAGGCGCTGGACA
ACCAGGGCGGCAGCCTGAAGGGGGCGACCGTCCGGGTCGACGCCGGGCACCTGGACAACCGTGGCGGCAA
GCTGCTCGCCGAGGGCGAACTGCGGGTCGAGGCGAGCAGCCTGGACAACCGCCAGGACGGCCTGTTGCAG
AGCCGGGACCGCGCCGTGGTCAAGACCCGTGGCGATCTCGACAACCGTGGCGGCCAGGTGATCGGCCTGA
ACGATCTGGAGGTCGGCGCGGCGACGCTCGACAACGGCCAGCAAGGCCTGCTCGGCAGCCAGCAGTCCAC
CCGCGTCAGCGCCCAGGCGCTGGTCAACCGGGGGGACGGCGAAGTCTCCGGCAAGCGCGTCGAGGCTCGC
GTCGGTAGCCTCGACAATCGCGGCGGCAAGCTGATCGGCGACGACCTGCTGGTGGTCGCCAGCGGTGCCA
TCGACAACCGCCTCGGCTTGTTCTCCGCAGCCAACCGCCTCGACCTGCGGGCGCGCAGCCTGGACAACAG
CGGCAAGGGCACGCTGAGCAGCCGGGGCGGCCTGGAGGTCAGCCTCGGCGGCCTGCTGGACAACCGCGAT
GAAGGCAACCTGCTCAGCCAGGGCGCGCAGCGCGTGACGGTGGGGCAACTGGACAACCGCGCCGGCGGCC
TGCTGTCGAGCCGCAGCGAGTTGAACGTCCACGGCGCCAGCCTGGACAACCGTGGCGGCGTGCTGGTGGC
CGACGCCGGCCTGAGCGCCACGGGAGGCGCCTTCGACAACCGCGACGGCGGCAGCGCCAGCGGCAAGGCT
GGCGTGCGCGTGGAGGTCGCCAGCCTGCGCAACGACCAGGGTGGCAAGCTGCTCAGCGATGGCCGCCTGG
ACCTCGCAGCGAACGCCGTCGGCAACGCCGGAGGGCGTATCGCCGCCAAGGGCGACCTGCAGGCGACGCT
TGGCAGCCTGGCCCAGCAAGGTGGCGAACTGGTCAGCGAAAAGACCCTGAAGGTCGCGGCCGACACGCTC
GACAACAGCCAGTCCGGGCTGATCGCCGCGAATGGCGGCATCGCTATCGAGGCGCGGCAGGTCGACAACC
GCGCCGGCGAGATTTCCAGCACCTCGAAGGTCGCCGTGAACGCCCGCGAGCAACTGGACAACCGCGGCGG
CAAGGTCATCGGCGACAGCGGCCTGCGCCTCACCGTGCAGCGCCTGCTGAACCAGGCCAAGGGGGTGCTG
GCCGGGCGCGACGGCCTGAGCCTGGACGGCGGCGAACTGTTCAACGGCGACGGCGGTCGGCTCGACAGCC
AGAACAGCCTGAGCGTGAGCCTCGGCGGCGTGCTGGACAACCAGGGCGGCGCGCTGGTCAGCGAAGGCAG
CCTGACGGCGCGCGCCGCGCGCCTGGACAACCGTGGCGGGACCTTCTCCAGCGCCGGTGCGCTGGCGCTG
ACCAGCCAGGCCGCGCTGGACAACCAGGGCGGCAGGCTGCTCAGCGATGCCGGCGTGACGCTGCAGGGCG
CCAGCCTCGACAACAGCCGTTCCGGCGTGATCAGCGCCAAGGGCGCGGTGGATATCCGCACCGGCGTACT
GGACAACAGCCGCAACGGCGGCATCGGCAGCAACGCCGGCATCACCCTGGTGGCCGCCCGGCTGGACAAC
GGCCAGCAGGGCCGGGTCAGCGCCAAGGGCCTGCTCGACGCCAACCTGAAAGGCCTCGACCAGCGCGGAG
GCGGCGTCCTGATCAGCGAAACCGGCGTCACCCTCGACCTCAATGGCGGCACGCTGGTCAACCGCGACGG
CGGCCTGATCGCCACGCCCGGCGCGCTGCTGCTGCGCCAGCTCGGCGCGGTGGACAACGGCGCCGGCGGG
GAAATCTCCAGCGACCGCGCCTTCACCCTCGCCGCCGCCAGCCTGGACAACCGCGGCGGGCGCCTGATCG
GCGCCGCCAACCTGACCCTGCGCATCGCCCAGGCCCTGGACAACAGCCTGGCCGGGGTGATCTCCGGCGC
CGCCGGCCTGGACATCGCGGCCGCTCGCCTGGACAACAGCGCCAAGGGCACCCTGGCCAGCCGCGCCGGC
ATCGACCTGCGCGTCGATGGCGCGCTGGACAACCACGCCGAAGGCACCGTCTCCGGCGCCCGCCTGACGC
TCGCCAGCGCCTCGCTGGACAACAGCGGCAAGGGCCTGCTCTCCGGCAACGCCGGCCTGAGCGTCGCCAC
TGGCGCGCTGGACAACGCCGAGGGTGGCCAGTTGATCAGCCAGGGCGTCCTGGACGTCAGCAGCGCCGAC
CTCGACAACCGTGGCGGCGCCCTCAGTGGCAAGCAGTCGCTGCGCCTGAGCGCCGCCAACCTGGACAACC
GTGGCGGCCTGCTCACCAGCGACGGCGAACTGGAACTGACGGCAGGGCGCGTCGATTCCGCCGACGGCGG
CGAAATCTCCGCCCGGGGCGACCTGCGCCTGACGGTCGAGCGCCTGGTGCAACGCCAGGGCCGGCTGGTC
GGCGAGCGCGGCGTCAGTCTCGACCTGCGGGGCGGCGACCTGGACAACCAGGGCGGCCTGATCAGTGCCC
GCGGCCCGCTGAGCATCGAGCGGCTGAGCGTCCTCGACAACCGCCAGGGCGGCGAGATTTCCAGCCAGCA
GGGCTTCGAGCTGCTGGCCAGGCGCATCGACAACGGCCAGCAGGGGCGCATCATCAGCGCCGGGAAACTG
CGCCTAGACGCCGACGCGCTGGGCAACGCCGGCGCCGGCCTGCTCTCCGGATGGCAGGGCCTGACGGTGA
CAGGCGGGAGCCTGGACAACAGCGCCGGCGGCACCCTTTCGAGCAAGGACGGCGAGCTGGCCATCAGCCT
CGGCGGCGCGCTGGACAACCACGGCCAGGGCGCGCTGGTCAGCAAGGGCGCGCAACGGATCGACGCCGCC
AGCCTGGATAACGCCCAGGGCATTGTCTCCGGCGAAAGCGACGTGACCCTGAGCATCGCCGGGAAGCTGG
ACAACGGCCAGGGCGGCCTGGTCTCGGCGCAGCGCGCGCTGAGCTTCGAGCGCGACGATACGCTGCTGAA
CAACGCCGGCGGCCGGATCAACGGCGGCAGCCTGCTGCTCAAGGGCGCCAGCCTGGATAACAGCGACGGC
CAGTTGATCAGCCAGGGCCGGCTCGACGCCATCCTCGGCGGCGCCCTGGTCAACACCGGCGCGGCGCGCC
TGGCCAGCGGCGGCGACCTGCTGCTGCGCAGCGCCAGCGTCGACAACCGCGGCGGCAAGCTGGTCAGCCA
GGGGCTGCTGGAGATCAGCGCCGGCAGCCTCGACAACAGCGCCTCCGGCACCCTCGCCAGCCAGGCCGGC
ATGAGCCTGCGCCTGGGCGGCGGCGCCCTGCGCAACCAGCAGGACGGCCTGATCTTCAGCCAGGCCGGCG
CCCTCGATGTGCAGGCCGGCAGCCTGGACAACCGCCAGGGCACGCTCCAGGCCCAGGGCGACAACCGGCT
GCGTATCGGCGGCGCGCTGGACAACCAGGGCGGCCGCCTGGACAGCCGGGCCGGCAACCTCGACCTGCAG
AGCGGCAGCCTCGACAACGGCGCCGGCGGCGTGCTCAACAGCGCCAAGGGTTGGCTGAAGCTGGTCACCG
GGCTGTTCGACAACAGCGCCGGCGTCACCCAGGCGCAGTCGCTGGAGATTCGCGCCGGGCAAGGCGTGCG
CAACCAGCAGGGCCACCTCTCGGCGCTGGGCGGCGACAACCGCATCGTCACCGCCGACTTCGACAACCAG
GGCGGCGGCCTCTACGCCAGCGGCCTGCTCAGCCTCGACGGCCAGCGCTTCCTCAACCAGGGCGCGGCGG
CGGGCCAGGGCGGCAAGGTCGGCGCCGGGCGCATCGACTTCAGCCTGGCCGGCGCGCTGGCCAACCGCTT
CGGCCAGTTGGAAAGCGAAAGCGAGCTGCACCTGCGCGCCGCCGCGATCGACAACAGCGGCGGCAGCCTG
CGCGCCCTCGGCCGCAGCGGCAGCACGCGGTTGGTCGCTGGCGGCCTGAACAACGCCTACGGCGTGCTGG
AAAGCGCCAACCAGGACCTCGACCTGCAACTGGGCAGCCTGGCCAACGCCGGTGGGCGCATCCTCCACAC
CGGCAATGGCACCTTCGGCCTGGATTCCGGGCAGGTGATCCGCGCCGGCGGCGAACTGACCACCAATGGC
CTGCTGGACATCCGCGCCAGCGAATGGACCAACAGCAGCGTGCTGCAAGCCGGACGCCTGAACCTGGACA
TCGGCACCTTCCGCCAGACGGCCGAGGGCAAGCTGTTGGCGGTGCAGTCCTTCACTGGCCGCGGCGGCGA
CTGGAGCAACGACGGCCTGCTGGCCAGCGACGGCAGCTTCCGCCTCGACCTGAGCGGCGGCTACCGTGGC
AACGGCCGCGCCACCAGCCTCGGCGACTTCGCCCTGAACGCCGCCAGCCTCGACCTCGGCAACGCCGCCA
GCCTCGCCGGCGGTGCCAATGTCACGCTCGGCGCCGGCAACCTGCTGGTCAACCGTGGGCGGATCACCGC
CGCCGGCGACCTCGTGGCCAGCGCCGCGAGCCTGAACAACTACGGCACCCTGGGCGGCGGCGGCAACCTG
CGATTGAACGCGCCCGCCCTGCTCAACGAGCGCGGGTTGCTGTTCAGTGGCGCCGACATGACCCTGCGCG
CCGGCGACATCACCAACCTCTACGGGGATGTGTACAGCCTCGGCAGGCTGGATATCGCCCGCGACGATGC
GGGCAACCGTGCCGCCAGCCTGCGCAACCTTTCCGGGGTGATCGAGAGCGGCAAGGACTTCAGCCTGCGT
GCCAGCCTGATCGAGAACCGTCGCGCCGTGCTGGAAAGCAAGTCGGGCCTGTACACCGCGAAGATGGAGC
AGACCGCCTGCATCGAAGGCGTCAACGCGGGCGACTGCAGCGGCAAGCGCAACGCCATCTGGACCATCAC
CCAGCGCGACAAGACCGAGGTCACCGCCAGCAGCGCCATGGGGCAACTGCTGGCCGGAGGCGACTTCGCC
ATCGACGGCGGCACCCTGAACAACCTTTCCAGTCTGATCGGCAGCGGCGGCAACCTCACCGCCAACCTCG
AAGTCCTCGACAACCAGGGCCTGGAAACCGGCGAGCTGGAAACCATCCGCGTGCTGCGTACCGCTCGCGG
CGGCGATATCGGCGGCATCGACCAGAAGTCGCGCAACTTCACCAACCTCTACTGGTACCAGAGCGCCAAT
TTCGACCCGGCGCGCGCGGGCGAGATCCCCGCCGCGCTCAACGCGATCCTCAGCGACTGGTCCTTCGAGT
ACGAATTCCCGAGCAAGGGGCCGACCCCGATCAGCAGTGGCGACCAGTCCTACGCAGCGGTGATCCAGGC
CGCCGGCGACGTCACGGTCAATGCCAGCACGCGCATCGACAACGGCGTCACCCGCCCCGGCTACACCTTC
GTCGGCAGCGGCCGCCAGGTGGGCGACAGCGCGGTGGGCGGCAGCGGGGTTTCGGTGGTCGTGCCGCTGA
CCTCGCAACTGCCGCCCGACCTGGCGCGGCGCCAGGTCAACCCGGTTACCCTGCCCGGCTTCAGCCTGCC
CCAGGGTGACAACGGCCTGTTCCGTCTCAGCTCGCGCTTTGCCGAGGACGGCAATGGCAGCGCCGCGCTC
GGTGCCGGCGCCGACCGCACCCAGGGCGGTAGCGGCGTCTCGGTCGGCCAGCAAGGCGCCGGCAACGCCG
CCGGTACCTGGCAGGGCCAGGGCGTGCGAGTCGACGGCCTGGCTGGCGCGGCCAACGTCCAGGGTCAGGG
CGGCAGCACGCTCGGCGGTAGCCTGCCGGGCGTCGCCCGGGTCCAGGGCGTGCCCGGCAACGCCACGCCG
AGCGCCAGCCACAAGTACCTGATCGAGACCAACCCGGCGCTCACCGAACTGAAGCAGTTCCTCAACTCGG
ACTACCTGCTCAGCGGCCTGGGCATGAACCCGGACGATAGCAAGAAGCGTCTCGGCGACGGTCTCTACGA
GCAGCGGCTGATCCGCGACGCGGTGGTGGCGCGCACCGGCCAGCGCTACATCGACGGGCTGAGCAGCGAC
GAGGCGCTGTTCCGCTACCTGATGGACAACGCCATCGCTTACAAGGACCAACTGCACCTGCAACTGGGTG
TGGGCCTGAGCGCGGAGCAGATGGCGGCGCTGACCCACGACATCGTCTGGCTGGAAGAGGTCGAGGTGAA
CGGCGAGAAGGTCCTCGCGCCGGTGGTCTACCTGGCCCAGGCGGAGGGTCGGCTGGCACCCAACGGTGCG
CTGATCCAGGGCCGCGACGTGAAGCTGGTGAGCGGCGGCGACCTGCATAACGTCGGCACCCTGCGCGCGC
GGAACGACCTCTCGGCGACGGCCGACAACCTCGACAACAGCGGCCTGATCGAGGCCGGCAAGCGCCTCGA
CCTGCTCGCCGGCGACTCGATCCGCAACCGCCAGGGCGGGGTCATCGCCGGGCGTGACGTGAGCCTCACC
GCGCTGACCGGCGACGTAATCAACGAACGCAGCGTGACCCGCTACGACAGCGCGCTCGACGGCCGCACCT
GGGAACGCAGCTTCGCCGACAGCGCCGCGCGGGTGGAGGCGGCGAACAGCCTGAACGTCCAGGCCGGACG
CGACATCGCCAACCTCGGCGGGGTGCTGCAGAGCCGCGGCGACCTCAGCCTCGACGCCGGACGCGACGTC
ACCGTCGCCGCCGTCGAGGACCGCCAGGGCCAGACCCGCTGGAGCACGTCGCGGCTCCAGAGCGTGACCC
AGCTCGGCGCCGAAGTCAGCGCCGGGCGGGACCTGAACGTCAGCGCCGGCCGCGACTTGACGGCGGTGGC
CAGCACCCTCGAAGCGCGCCGCGACATCGCCCTCTCCGCCGGGCGCGACGTGACCCTGGCGGCGGCGGCG
AACGAGGAGCATGCCTACAGCAAGACCAGGAAGGTCACCTACCAGGAAGACAAGGTCGCCCAGCAAGGCA
CCCGCGTGGACGCCGGCGGCGACCTGGCGATCAATGCCGGACAGGACCTGCGCCTGATCGCGAGCCAGGC
CAGCGCCGGCGACGAGGCCTACCTGGTGGCCGGCGACAAGCTGGAACTGCTGGCCGCCAACGACAGCAAC
TACTACCTGTACGACAAGAAGAAGAAAGGCGACTTCGGCCGCAAGGAAACCCGGCGCGACGAAGTCACCG
ACGTCAAGGCGGTGGGCAGCCAGATCAGCAGCGGCGGCGACCTCACCCTGCTCAGCGGCGGCGACCAGAC
CTACCAGGGCGCGAAGCTGGAATCGGGCAACGACCTGGCCATCGTCAGCGGCGGCGCGGTGACCTTCGAG
GCGGTGAAGGACCTGCACCAGGAAAGCCACGAGAAGAGCAAGGGCGACCTGGCGTGGAACAGCGCCAAGG
GGAAAGGGCAGACCGATGAAACGCTTCGGCAGACCCAGATCGTGGCCCAGGGGAATCTGGCGATCAAGGC
CGTGGAAGGGCTGAAGATCGACCTCAAGCATATCGACCAGAAGACCGTAAGCCAGACCATCGACGCGATG
GTGCAGGCGGATCCGCAACTGGCGTGGCTGAAGGAGGCCGAGCAGCGCGGGGATGTGGACTGGCGCATGG
TGCAGGAGGTGCACGATAGCTGGAAGTACAGCAACTCGGGCATGGGGCCGGCGACGCAGATCGCTGTCGC
CATCGCGGCGGCAGCCATCGGTGGCATGGCGGCAGCGGGAGCGCTCAGTGGTGCAGGAGTGGGTGCCAGT
AGCTTCGCCATGGGCGCAGGAGTTGGTGCGGCAGGAAGCCTGTCGGGCACGGCAGCGGTCAGCCTGATCA
ACAACAAGGGCGATCTCGGGAAGGTGCTGAAAGACAGCTTCAGTAGTGACAGTCTGAAGCAGATTGCTAT
TGCGAGCCTGACCGGGGGGCTGACGGCTGAGTACTTCGACGGGATTCTTCAGACCAAGACTGATCCGCTT
ACTGGAAAGGTCACGGTAGACCTCAGCAGCCTATCTGGTGTTGGTCGCTTCGCTGCCAATCAGGCGATGC
AGAACGCTACATCCACTGTACTGAGCCAGGCCTTGGGCCAGGGCGGGAGCCTGAACGAGGCGCTGAAGAG
CGCGCTCTACAACAGTTTCGCGGCGGCAGGTTTCAACTTCGTCGGCGATATCGGCCAGGAATACAGCCTG
AAGCCAGGCGATCCTTCGATGGTGACCATGCACGCCCTGATGGGTGGCCTGGCGGCGCAGGTCAGCGGTG
GCGATTTCGCCACGGGCGCCGCGGCGGCTGGCGCCAATGAAGCGCTGGTGGCCAAGCTAGACCAGGCCTT
CAAGAGCTTGAGCCCTGAGAACCGTGAAGCCATGGTCACTATGGGGTCGCAATTGGTTGGTGTTCTGGCT
GCGGCGGTACGCGATCCTGATGTGACAGGCAAAGCTCTGGAAAGCGCTGCTTGGGTAGCGAAGAACTCGA
CGCAATACAACTTCCTCAACCATCAGGATGTGGCCGATCTGGATAATGCCTTGCAGAAATGCAAGTCCCA
GGGAAATTGCCGTCAGGTAGAGGAAGAGTTCAAGGCGCGTAGCGACGAGAACCGGCGGAGGTTGAATGGC
TGCGTGGCTGTGGGTAATTGCGCGGAGATTCGTGCGGAGATCGATGCGGGGTCTACGGCTCTCAACGAGC
TGGTGGCCCGGCAGGAAACAGCTAATCCGGGAGGAAGTGACAGCGATATAGCCTACGGTTTCCTGATGGG
CCGAAATGTTGTCGACTGGACGACGGCTGGTCAGTTGCACCTGGAGCAGACCGCCAACCTCTGGTGGAAC
GGTAATCCACAGTGGCAGAAGGAAGTCGGTGCATACCTAGACCAGACGGGGTTCAATCCGTTCGGAATCG
GCGTTCCGGCAATGGGCGGTGCCGCTGGCAAGGTAACGGCCAAGGCGCTCATGAATGCGCTGAAGGCGGG
AGAGTTGCCCAAAGGAGAGGTGGCCCCAGGAAAGGCTAATCTGCCTACCATTGGGGCGTTGGCGGATGCT
GAGGCGGGAATGCCTTATACCCATCCAGTTAAGCTCGCCGCAAAAGCGACTGGGACAGCAGGGAAGATTA
AGATTGAAGCCGGCGCAATACCTGACGCAAATGAAGTACGTGCAGGACAAGGGTTATCTGGTCTTGGGTA
CGATGTTACGCACCAAACCACTGCGTCAGCTAAAGGTATTCAAGGGCAGCGAACTGCGGACTTGCATGTT
GATGGACTCGGTTCCATTGATGTGTATACGCCGAAGAATCTTGATCCGACAAAGATAGTTCGAGCGATAG
AGAAGAAGTCGAATCAAGCCGGCGGAGTCTTGGTGCAGGCGGACTTGCCAAGCACTGACATGTCGTCCAT
TGCTGCTCGTATGTGGGGGAAGACTAACGCGCAGAGTATAAAAACTATATTTTTCCAGAAACCAGACGGA
TCATTGGTCCGATTTGATCGACCTGCTGGAGGAGGCTG
Protein Sequence
>gi|15595239|ref|NP_248731.1| hemagglutinin [Pseudomonas aeruginosa PAO1] MDIRSPLNQCIALSLAGILFLNPIVAAAAGLALDKAAGGNTGLGQAGNGVPIVNIATPNDAGLSNNHFRDYNVGANGLILNNATGKTQGTQLGGIILGNPNLKGQAAQVILNQVTGGNRSTLAGYTEVAGQSARVIVANPHGITCQGCGFINTPRATLTTGKPIMDGQRLERFQVDGGDIVVEGAELNVGNLEQFDLITRSAKLNAKLYAKNLNIVTGRNDVQADSLQATPRAADGSEKPQLAIDSSALGGMYAGAIRLVGTEQGVGVRLAGDMAASGGDIRIDASGKLSLAQASSQGDLKIAAQAVELNGKTYAGGSAEIRSAEELVNRQSLAARERIVLEAAHIDNAGVIEAGVEPDERRNARGDLELRSGTLRNAGSLVASRALEAKASQALDNQGGSLKGATVRVDAGHLDNRGGKLLAEGELRVEASSLDNRQDGLLQSRDRAVVKTRGDLDNRGGQVIGLNDLEVGAATLDNGQQGLLGSQQSTRVSAQALVNRGDGEVSGKRVEARVGSLDNRGGKLIGDDLLVVASGAIDNRLGLFSAANRLDLRARSLDNSGKGTLSSRGGLEVSLGGLLDNRDEGNLLSQGAQRVTVGQLDNRAGGLLSSRSELNVHGASLDNRGGVLVADAGLSATGGAFDNRDGGSASGKAGVRVEVASLRNDQGGKLLSDGRLDLAANAVGNAGGRIAAKGDLQATLGSLAQQGGELVSEKTLKVAADTLDNSQSGLIAANGGIAIEARQVDNRAGEISSTSKVAVNAREQLDNRGGKVIGDSGLRLTVQRLLNQAKGVLAGRDGLSLDGGELFNGDGGRLDSQNSLSVSLGGVLDNQGGALVSEGSLTARAARLDNRGGTFSSAGALALTSQAALDNQGGRLLSDAGVTLQGASLDNSRSGVISAKGAVDIRTGVLDNSRNGGIGSNAGITLVAARLDNGQQGRVSAKGLLDANLKGLDQRGGGVLISETGVTLDLNGGTLVNRDGGLIATPGALLLRQLGAVDNGAGGEISSDRAFTLAAASLDNRGGRLIGAANLTLRIAQALDNSLAGVISGAAGLDIAAARLDNSAKGTLASRAGIDLRVDGALDNHAEGTVSGARLTLASASLDNSGKGLLSGNAGLSVATGALDNAEGGQLISQGVLDVSSADLDNRGGALSGKQSLRLSAANLDNRGGLLTSDGELELTAGRVDSADGGEISARGDLRLTVERLVQRQGRLVGERGVSLDLRGGDLDNQGGLISARGPLSIERLSVLDNRQGGEISSQQGFELLARRIDNGQQGRIISAGKLRLDADALGNAGAGLLSGWQGLTVTGGSLDNSAGGTLSSKDGELAISLGGALDNHGQGALVSKGAQRIDAASLDNAQGIVSGESDVTLSIAGKLDNGQGGLVSAQRALSFERDDTLLNNAGGRINGGSLLLKGASLDNSDGQLISQGRLDAILGGALVNTGAARLASGGDLLLRSASVDNRGGKLVSQGLLEISAGSLDNSASGTLASQAGMSLRLGGGALRNQQDGLIFSQAGALDVQAGSLDNRQGTLQAQGDNRLRIGGALDNQGGRLDSRAGNLDLQSGSLDNGAGGVLNSAKGWLKLVTGLFDNSAGVTQAQSLEIRAGQGVRNQQGHLSALGGDNRIVTADFDNQGGGLYASGLLSLDGQRFLNQGAAAGQGGKVGAGRIDFSLAGALANRFGQLESESELHLRAAAIDNSGGSLRALGRSGSTRLVAGGLNNAYGVLESANQDLDLQLGSLANAGGRILHTGNGTFGLDSGQVIRAGGELTTNGLLDIRASEWTNSSVLQAGRLNLDIGTFRQTAEGKLLAVQSFTGRGGDWSNDGLLASDGSFRLDLSGGYRGNGRATSLGDFALNAASLDLGNAASLAGGANVTLGAGNLLVNRGRITAAGDLVASAASLNNYGTLGGGGNLRLNAPALLNERGLLFSGADMTLRAGDITNLYGDVYSLGRLDIARDDAGNRAASLRNLSGVIESGKDFSLRASLIENRRAVLESKSGLYTAKMEQTACIEGVNAGDCSGKRNAIWTITQRDKTEVTASSAMGQLLAGGDFAIDGGTLNNLSSLIGSGGNLTANLEVLDNQGLETGELETIRVLRTARGGDIGGIDQKSRNFTNLYWYQSANFDPARAGEIPAALNAILSDWSFEYEFPSKGPTPISSGDQSYAAVIQAAGDVTVNASTRIDNGVTRPGYTFVGSGRQVGDSAVGGSGVSVVVPLTSQLPPDLARRQVNPVTLPGFSLPQGDNGLFRLSSRFAEDGNGSAALGAGADRTQGGSGVSVGQQGAGNAAGTWQGQGVRVDGLAGAANVQGQGGSTLGGSLPGVARVQGVPGNATPSASHKYLIETNPALTELKQFLNSDYLLSGLGMNPDDSKKRLGDGLYEQRLIRDAVVARTGQRYIDGLSSDEALFRYLMDNAIAYKDQLHLQLGVGLSAEQMAALTHDIVWLEEVEVNGEKVLAPVVYLAQAEGRLAPNGALIQGRDVKLVSGGDLHNVGTLRARNDLSATADNLDNSGLIEAGKRLDLLAGDSIRNRQGGVIAGRDVSLTALTGDVINERSVTRYDSALDGRTWERSFADSAARVEAANSLNVQAGRDIANLGGVLQSRGDLSLDAGRDVTVAAVEDRQGQTRWSTSRLQSVTQLGAEVSAGRDLNVSAGRDLTAVASTLEARRDIALSAGRDVTLAAAANEEHAYSKTRKVTYQEDKVAQQGTRVDAGGDLAINAGQDLRLIASQASAGDEAYLVAGDKLELLAANDSNYYLYDKKKKGDFGRKETRRDEVTDVKAVGSQISSGGDLTLLSGGDQTYQGAKLESGNDLAIVSGGAVTFEAVKDLHQESHEKSKGDLAWNSAKGKGQTDETLRQTQIVAQGNLAIKAVEGLKIDLKHIDQKTVSQTIDAMVQADPQLAWLKEAEQRGDVDWRMVQEVHDSWKYSNSGMGPATQIAVAIAAAAIGGMAAAGALSGAGVGASSFAMGAGVGAAGSLSGTAAVSLINNKGDLGKVLKDSFSSDSLKQIAIASLTGGLTAEYFDGILQTKTDPLTGKVTVDLSSLSGVGRFAANQAMQNATSTVLSQALGQGGSLNEALKSALYNSFAAAGFNFVGDIGQEYSLKPGDPSMVTMHALMGGLAAQVSGGDFATGAAAAGANEALVAKLDQAFKSLSPENREAMVTMGSQLVGVLAAAVRDPDVTGKALESAAWVAKNSTQYNFLNHQDVADLDNALQKCKSQGNCRQVEEEFKARSDENRRRLNGCVAVGNCAEIRAEIDAGSTALNELVARQETANPGGSDSDIAYGFLMGRNVVDWTTAGQLHLEQTANLWWNGNPQWQKEVGAYLDQTGFNPFGIGVPAMGGAAGKVTAKALMNALKAGELPKGEVAPGKANLPTIGALADAEAGMPYTHPVKLAAKATGTAGKIKIEAGAIPDANEVRAGQGLSGLGYDVTHQTTASAKGIQGQRTADLHVDGLGSIDVYTPKNLDPTKIVRAIEKKSNQAGGVLVQADLPSTDMSSIAARMWGKTNAQSIKTIFFQKPDGSLVRFDRPAGGG
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: PA0041 mutant is attenuated in rats (Potvin et al., 2003).
COG COG3210U, under U: Intracellular trafficking, secretion, and vesicular transport
References
Potvin et al., 2003: Potvin E, Lehoux DE, Kukavica-Ibrulj I, Richard KL, Sanschagrin F, Lau GW, Levesque RC. In vivo functional genomics of Pseudomonas aeruginosa for high-throughput screening of new virulence factors and antibacterial targets. Environmental microbiology. 2003; 5(12); 1294-1308. [PubMed: 14641575].