Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

pgk

Victor ID 4225
Gene Name pgk
Sequence Strain (Species/Organism) Pseudomonas aeruginosa
NCBI Gene ID 879198
NCBI Protein GI 15595749
Locus Tag PA0552
Protein Accession NP_249243.1
Other Database IDs UniProtKB-ID: PGK_PSEAE
UniRef100: UniRef100_Q02TL3
UniRef90: UniRef90_Q02TL3
UniRef50: UniRef50_A1WVV5
UniParc: UPI0000131808
EMBL: AE004091
EMBL-CDS: AAG03941.1
RefSeq_NT: NC_002516.2
GenomeReviews: AE004091_GR
KEGG: pae:PA0552
PseudoCAP: PA0552
HOGENOM: HBG453500
OMA: NCAIILP
ProtClustDB: PRK00073
BioCyc: PAER208964:PA0552-MONOMER
Taxonomy ID 208964
Gene Starting Position 611280
Gene Ending Position 612443
Gene Strand (Orientation) +
Protein Name phosphoglycerate kinase
DNA Sequence
>gi|110645304:611280-612443 Pseudomonas aeruginosa PAO1 chromosome, complete genome
CATGACCGTGTTGAAGATGACTGACCTCGACCTCAAAGGTAAGCGCGTGCTGATCCGCGAGGACCTCAAC
GTGCCCGTGAAGGACGGCCAGGTGCAGAGCGATGCACGGATCAAGGCCGCCCTGCCGACCCTCAAGCTGG
CCCTGGAGAAGGGCGCGGCGGTGATGGTCTGCTCGCACCTGGGCCGTCCGACCGAGGGCGAGTTCTCCGC
CGAGAACAGCCTGAAGCCGGTGGCCGAGTACCTGTCCAAGGCCCTGGGCCGCGAAGTGCCGCTGCTGGCC
GACTACCTCGACGGCGTCGAGGTCAAGGCGGGCGACCTGGTGCTGTTCGAGAACGTGCGCTTCAACAAGG
GCGAGAAGAAGAACGCCGACGAGCTGGCGCAGAAGTACGCCGCGCTGTGCGACGTGTTCGTGATGGATGC
CTTCGGTACCGCCCACCGCGCCGAGGGGTCGACCCACGGCGTGGCCAGGTTCGCCAAGGTCGCCGCCGCC
GGCCCGCTGCTGGCCGCCGAACTGGACGCGCTGGGCAAGGCGCTGGGCAACCCGGCGCGGCCGATGGCGG
CGATCGTCGCCGGCTCCAAGGTTTCCACCAAGCTCGACGTGCTGAACAGCCTGGCCGGCATCTGCGACCA
ACTGATCGTCGGCGGCGGCATCGCCAACACCTTCCTCGCCGCGGCCGGACACAAGGTCGGCAAGTCACTG
TACGAGGCCGACCTGGTCGAGACCGCCAAGGCCATCGCCGCCAAGGTCAAGGTGCCGCTGCCGGTGGACG
TGGTGGTGGCCAAGGAATTCGCCGAGAGCGCCGTGGCGACCGTCAAGGCCATCGCCGAGGTCGCCGACGA
CGACATGATCCTCGACATCGGCCCGCAGACCGCCGCGCAGTTCGCCGAGCTGCTGAAGACCTCGAAGACC
ATCCTGTGGAACGGTCCGGTCGGGGTGTTCGAGTTCGACCAGTTCGGCGAGGGCACCCGTACCCTGGCCA
ATGCCATCGCCGATAGCGCGGCGTTCTCCATCGCCGGCGGCGGCGATACCCTGGCGGCGATCGACAAGTA
CGGCATCGCCGAGCGGATCTCCTATATTTCCACCGGTGGCGGCGCGTTCCTCGAGTTCGTCGAGGGCAAG
GTCCTGCCGGCCGTGGAAATCCTGGAGCAGCGCGCCAAGGGCTG
Protein Sequence
>gi|15595749|ref|NP_249243.1| phosphoglycerate kinase [Pseudomonas aeruginosa PAO1] MTVLKMTDLDLKGKRVLIREDLNVPVKDGQVQSDARIKAALPTLKLALEKGAAVMVCSHLGRPTEGEFSAENSLKPVAEYLSKALGREVPLLADYLDGVEVKAGDLVLFENVRFNKGEKKNADELAQKYAALCDVFVMDAFGTAHRAEGSTHGVARFAKVAAAGPLLAAELDALGKALGNPARPMAAIVAGSKVSTKLDVLNSLAGICDQLIVGGGIANTFLAAAGHKVGKSLYEADLVETAKAIAAKVKVPLPVDVVVAKEFAESAVATVKAIAEVADDDMILDIGPQTAAQFAELLKTSKTILWNGPVGVFEFDQFGEGTRTLANAIADSAAFSIAGGGDTLAAIDKYGIAERISYISTGGGAFLEFVEGKVLPAVEILEQRAKG
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: pgk mutant is attenuated in rats (Potvin et al., 2003).
COG COG0126G, under G: Carbohydrate transport and metabolism
References
Potvin et al., 2003: Potvin E, Lehoux DE, Kukavica-Ibrulj I, Richard KL, Sanschagrin F, Lau GW, Levesque RC. In vivo functional genomics of Pseudomonas aeruginosa for high-throughput screening of new virulence factors and antibacterial targets. Environmental microbiology. 2003; 5(12); 1294-1308. [PubMed: 14641575].