Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

algC

Victor ID 4229
Gene Name algC
Sequence Strain (Species/Organism) Pseudomonas aeruginosa PAO1
NCBI Gene ID 879406
NCBI Protein GI 15600515
Locus Tag PA5322
Protein Accession NP_254009.1
Other Database IDs UniProtKB-ID: ALGC_PSEAE
UniRef100: UniRef100_P26276
UniRef90: UniRef90_P26276
UniRef50: UniRef50_Q88C93
UniParc: UPI0000165EDE
EMBL: M60873
EMBL: AE004091
EMBL-CDS: AAA25701.1
EMBL-CDS: AAG08707.1
RefSeq_NT: NC_002516.2
PDB: 1K2Y
PDB: 1K35
PDB: 1P5D
PDB: 1P5G
PDB: 1PCJ
PDB: 1PCM
PDB: 2FKF
PDB: 2FKM
PDB: 2H4L
PDB: 2H5A
PDB: 3BKQ
PDB: 3C04
GenomeReviews: AE004091_GR
KEGG: pae:PA5322
PseudoCAP: PA5322
HOGENOM: HBG644964
OMA: EVGAYNQ
ProtClustDB: CLSK869263
BioCyc: PAER208964:PA5322-MONOMER
Taxonomy ID 208964
Gene Starting Position 5992382
Gene Ending Position 5993773
Gene Strand (Orientation) +
Protein Name phosphomannomutase AlgC
DNA Sequence
>gi|110645304:5992382-5993773 Pseudomonas aeruginosa PAO1 chromosome, complete genome
CATGAGCACTGCAAAAGCACCGACGCTGCCCGCCAGCATCTTCCGCGCCTACGACATCCGTGGCGTGGTA
GGCGATACCCTCACCGCCGAGACCGCCTACTGGATCGGTCGCGCCATCGGCTCGGAAAGCCTCGCCCGCG
GCGAACCGTGCGTCGCTGTCGGCCGCGATGGCCGCCTGTCCGGTCCCGAGCTGGTCAAGCAGCTGATCCA
GGGCCTGGTGGACTGCGGTTGCCAGGTCAGCGACGTGGGCATGGTGCCTACCCCGGTGCTGTACTACGCG
GCCAACGTGCTCGAGGGCAAGTCCGGGGTGATGCTGACCGGCAGCCACAACCCGCCGGACTACAACGGCT
TCAAGATCGTGGTCGCCGGAGAGACCCTGGCCAACGAGCAGATCCAGGCCCTGCGCGAGCGCATCGAGAA
AAACGACCTGGCATCCGGCGTCGGCAGCGTAGAGCAGGTCGACATCCTGCCGCGCTACTTCAAGCAGATC
CGCGACGACATCGCCATGGCCAAGCCGATGAAGGTGGTGGTCGACTGCGGCAACGGCGTGGCCGGGGTGA
TCGCCCCGCAGTTGATCGAGGCCCTGGGCTGCAGCGTGATCCCGCTGTACTGCGAGGTCGACGGCAACTT
CCCGAACCACCATCCGGACCCGGGCAAGCCGGAGAACCTGAAGGACCTGATCGCCAAGGTCAAGGCCGAG
AACGCCGACCTGGGCCTGGCCTTCGACGGCGACGGCGATCGCGTCGGCGTGGTCACCAATACCGGTACCA
TCATCTATCCGGACCGTCTGCTGATGCTGTTCGCCAAGGACGTGGTCTCGCGCAACCCGGGGGCCGACAT
CATCTTCGACGTCAAGTGCACCCGCCGTCTGATCGCCCTGATCAGCGGCTACGGCGGCCGTCCGGTGATG
TGGAAGACCGGCCACTCGCTGATCAAGAAGAAGATGAAGGAAACCGGCGCCCTGCTGGCTGGCGAGATGA
GCGGCCACGTGTTCTTCAAGGAGCGCTGGTTCGGCTTCGACGATGGCATCTACAGCGCCGCCCGCCTGCT
GGAAATCCTCAGCCAGGATCAGCGTGACAGCGAGCACGTGTTCTCGGCCTTCCCGAGCGACATTTCCACC
CCGGAAATCAACATCACCGTCACCGAGGACAGCAAGTTCGCCATCATCGAGGCGCTGCAACGCGACGCCC
AATGGGGCGAAGGCAACATCACCACCCTCGACGGCGTGCGGGTCGACTACCCCAAAGGCTGGGGCCTGGT
ACGCGCCTCCAACACCACTCCCGTGCTGGTCCTGCGCTTCGAAGCGGACACCGAGGAAGAGCTGGAGCGC
ATCAAGACCGTCTTCCGTAACCAACTGAAGGCAGTGGATTCCTCGCTGCCCGTGCCCTTCTG
Protein Sequence
>gi|554753023|ref|NP_254009.2| phosphomannomutase [Pseudomonas aeruginosa PAO1] MKLFQRTAKDGNELGDLLEPEKKPRKAASERADGKDLLPGIGASLLGVAAAGALLWFGVFGGAGEAQQRQLDAAWAEGQAGALRQALQQLAADTRAAAASPLALEALQSGDATRIEAAQRSLLAWDGVVDAHLNAPGQAAQDNDSPGPVSFAALDILHRVESGQNVAAEAYKVGQRWLLYSAAPVRGADQSLQGTLLLAVDLQRLLRALPPLPGDAGQVQLVQQFSGAPAQVLLQRGTPAPGKGAQALDSGNPNWKLNYTPGSVASTQASPLLLALAALLALLGGILGTYLTRSSLLRRLHQDVLTLGQYLQELGGQRTAKPPVPSLPGFAPLIQALARQPRRKPEPTSVPSPAKAAPVAPVAVAKAPPREEPALADPLFQNTDILDIDILDEDQDLLGLEQTPIMSTAKAPTLPASIFRAYDIRGVVGDTLTAETAYWIGRAIGSESLARGEPCVAVGRDGRLSGPELVKQLIQGLVDCGCQVSDVGMVPTPVLYYAANVLEGKSGVMLTGSHNPPDYNGFKIVVAGETLANEQIQALRERIEKNDLASGVGSVEQVDILPRYFKQIRDDIAMAKPMKVVVDCGNGVAGVIAPQLIEALGCSVIPLYCEVDGNFPNHHPDPGKPENLKDLIAKVKAENADLGLAFDGDGDRVGVVTNTGTIIYPDRLLMLFAKDVVSRNPGADIIFDVKCTRRLIALISGYGGRPVMWKTGHSLIKKKMKETGALLAGEMSGHVFFKERWFGFDDGIYSAARLLEILSQDQRDSEHVFSAFPSDISTPEINITVTEDSKFAIIEALQRDAQWGEGNITTLDGVRVDYPKGWGLVRASNTTPVLVLRFEADTEEELERIKTVFRNQLKAVDSSLPVPF
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: algC mutant is attenuated in neonatal mouse model of infection (Tang et al., 1996).
COG COG1109G, under G: Carbohydrate transport and metabolism
References
Tang et al., 1996: Tang HB, DiMango E, Bryan R, Gambello M, Iglewski BH, Goldberg JB, Prince A. Contribution of specific Pseudomonas aeruginosa virulence factors to pathogenesis of pneumonia in a neonatal mouse model of infection. Infection and immunity. 1996; 64(1); 37-43. [PubMed: 8557368].