Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

clpV1

Victor ID 4231
Gene Name clpV1
Sequence Strain (Species/Organism) Pseudomonas aeruginosa PAO1
NCBI Gene ID 879553
NCBI Protein GI 15595288
Locus Tag PA0090
Protein Accession NP_248780.1
Other Database IDs UniProtKB-ID: CLPV1_PSEAE
UniRef100: UniRef100_Q9I742
UniRef90: UniRef90_Q9I742
UniRef50: UniRef50_Q9I742
UniParc: UPI00000C4F2B
EMBL: AE004091
EMBL-CDS: AAG03480.1
RefSeq_NT: NC_002516.2
HSSP: P63284
GenomeReviews: AE004091_GR
KEGG: pae:PA0090
NMPDR: fig|208964.1.peg.90
PseudoCAP: PA0090
HOGENOM: HBG413133
OMA: YGGEQNV
ProtClustDB: CLSK865589
BioCyc: PAER208964:PA0090-MONOMER
Taxonomy ID 208964
Gene Starting Position 108220
Gene Ending Position 110928
Gene Strand (Orientation) +
Protein Name ClpV1
DNA Sequence
>gi|110645304:108220-110928 Pseudomonas aeruginosa PAO1 chromosome, complete genome
CATGAGTGAGATCAGTCGCGTTGCGCTGTTCGGCAAGCTGAACAGCCTGGCCTACAAGGCCATCGAGGCC
GCCACGGTATTCTGCAAGCTGCGCGGCAATCCCTATGTCGAGCTGGTGCACTGGTTCCACCAGATCCTCC
AGTTGCCGGACTCGGACCTGCACCAGATCGTCCGCCAGTCCGGGATCGACCCGGCGCGCCTGGCCAAGGA
CCTGACCGAGGCCCTCGACCGTCTGCCGCGCGGCTCGACCTCGATCACCGACCTGTCCTCCCATGTCGAG
GAAGCGGTGGAGCGCGGCTGGGTCTACGGCAGCCTGATGTTCGGCGAGAGCCAGGTGCGCACCGGCTACC
TGGTGATCGGCATCCTCAAGACGCCGAGCCTGCGCCATGCCCTCACCGGGCTGTCGGCGGAATTCGCCAA
GCTCAAGGTCGAGGCGCTCACCGAGCGCTTCGACGAGTACGTCGGCGCCTCGCCGGAGAACGGCCTGTCG
GCCAGCGACGGCTTCAACGCCGGCGCCGCCCCGGGCGAGGCCAGCGGCGCCCTGGCGCCGAGCGCGATGG
GCAAGCAGGAGGCGCTCAAGCGCTTTACCGTGGACCTCACCGAGCAGGCCCGCAGCGGCAAGCTCGACCC
CATCGTCGGGCGTGACGAGGAGATCCGCCAGTTGGTGGACATCCTCATGCGCCGCCGGCAGAACAACCCG
ATCCTCACCGGCGAGGCCGGCGTCGGCAAGACCGCGGTGGTGGAAGGCTTCGCCCTGCGCATCGTCGCCG
GCGACGTCCCGCCGGCGCTGAAGGACGTCGAACTGCGCGCCCTCGACGTCGGCCTGCTGCAGGCCGGGGC
GAGCATGAAGGGCGAGTTCGAGCAGCGCCTGCGCCAGGTGATCGAAGACGTGCAGAGTTCCGAGAAGCCG
ATCATCCTGTTCATCGACGAAGCCCACACCCTGGTCGGCGCCGGTGGCGCGGCCGGCACCGGCGACGCCG
CCAACCTGCTCAAGCCGGCCCTGGCGCGCGGCACCCTGCGCACCGTGGCAGCGACCACCTGGGCCGAGTA
CAAGAAGCACATCGAGAAGGACCCGGCGCTGACCCGGCGTTTCCAGGTGGTGCAGGTGGACGAGCCGTCC
GAGCACAAGGCCATCCTGATGATGCGCGGCGTCGCGTCGACCATGGAGAAGCACCACCAGGTGCAGATCC
TCGACGAGGCGCTGGAGGCGGCGGTCCGGCTGTCGCACCGCTACATCCCGGCGCGCCAGCTGCCGGACAA
GTCGGTGAGCCTGCTGGATACCGCCTGCGCGCGCACCGCCATCAGCCTGCACGCGGTGCCGGCCGAGGTC
GACGATAGCCGCCGTCGCATCGAGGCGCTGGAAACCGAGCTGGCGATCATCCGCCGCGAGAGCGCCATCG
GCGTCGCCACCGCCGAACGCCAGCGCAACGCCGAGACCCTGCTGGCCGAGGAGCGCGAGCGCCTGGCCGC
CCTGGAGCAGCGCTGGGCCGAGGAAAAACGCCTGGTCGACGAACTGCTGGAGACCCGCGCCCGTCTGCGT
GCCGCCGCCGAAGCGGTGGATGCCGGCGGCGTGCCGCTGGGCGAAGGCGAGGTGCGTCTCGACGAGGAAC
AGCGCCAGGCGCTGCATGCGCGGCTGGCGGAGCTGCAGGCGCAACTGAGCGCGTTGCAGGGCGAAGAGCC
GCTGATCCTGCCGACCGTGGACTACCAGGCGGTGGCCTCGGTGGTCGCCGACTGGACCGGCATCCCGGTC
GGCCGCATGGCGCGCAACGAGATCGAGACCGTGCTCAACCTCGACCGGCACCTGAAGAAGCGCATCATCG
GCCAGGACCACGCGCTGGAGATGATCGCCAAGCGCATCCAGACTTCCCGCGCCGGCCTCGACAACCCGAG
CAAGCCGATCGGCGTGTTCATGCTCGCCGGCACCTCCGGGGTGGGCAAGACCGAGACCGCACTGGCCTTG
GCCGAGGCCATGTACGGCGGCGAGCAGAATGTCATCACCATCAACATGAGCGAGTTCCAGGAAGCCCACA
CCGTCTCCACCCTCAAGGGCGCCCCGCCCGGCTACATCGGCTACGGCGAGGGTGGCGTGCTGACCGAGGC
GGTGCGTCGCAAGCCCTACAGCGTGGTGCTGCTGGATGAAGTGGAGAAGGCCCACCCGGATGTCCACGAG
ATCTTCTTCCAGGTCTTCGACAAGGGCGTGATGGAGGACGGCGAAGGCCGGGTGATCGACTTCAAGAACA
CCCTGATCCTGCTCACCACCAACGCCGGCACCGAGATGATCGCCAGCCTCTGCGCCGATCCGGAACTGAT
GCCCGAGCCGGAAGCCATCGCCAAGTCGCTGCGCGAACCGCTGCTGAAGATCTTCCCGCCGGCGCTGCTC
GGCCGCCTGGTGACCATCCCCTACTACCCGCTCAGCGACGACATGCTCAAGGCCATTTCGCGCCTGCAAC
TGGGGCGGATCAAGAAGCGCGTGGAGGCGACCCACAAGGTGCCGTTCGAGTTCGACGAGGGCGTCGTCGA
CCTGATCGTCTCGCGCTGCACCGAGACCGAGAGCGGCGGCCGGATGATCGACGCGATCCTCACCAACACG
CTGTTGCCGGACATGAGCCGCGAGTTCCTCACCCGCATGCTCGAAGGCAAGCCGTTGGCCGGGGTACGTA
TCAGTAGCCGCGACAACCAGTTCCACTACGACTTCGCCGAGGCCGAGTG
Protein Sequence
>gi|15595288|ref|NP_248780.1| ClpV1 protein [Pseudomonas aeruginosa PAO1] MSEISRVALFGKLNSLAYKAIEAATVFCKLRGNPYVELVHWFHQILQLPDSDLHQIVRQSGIDPARLAKDLTEALDRLPRGSTSITDLSSHVEEAVERGWVYGSLMFGESQVRTGYLVIGILKTPSLRHALTGLSAEFAKLKVEALTERFDEYVGASPENGLSASDGFNAGAAPGEASGALAPSAMGKQEALKRFTVDLTEQARSGKLDPIVGRDEEIRQLVDILMRRRQNNPILTGEAGVGKTAVVEGFALRIVAGDVPPALKDVELRALDVGLLQAGASMKGEFEQRLRQVIEDVQSSEKPIILFIDEAHTLVGAGGAAGTGDAANLLKPALARGTLRTVAATTWAEYKKHIEKDPALTRRFQVVQVDEPSEHKAILMMRGVASTMEKHHQVQILDEALEAAVRLSHRYIPARQLPDKSVSLLDTACARTAISLHAVPAEVDDSRRRIEALETELAIIRRESAIGVATAERQRNAETLLAEERERLAALEQRWAEEKRLVDELLETRARLRAAAEAVDAGGVPLGEGEVRLDEEQRQALHARLAELQAQLSALQGEEPLILPTVDYQAVASVVADWTGIPVGRMARNEIETVLNLDRHLKKRIIGQDHALEMIAKRIQTSRAGLDNPSKPIGVFMLAGTSGVGKTETALALAEAMYGGEQNVITINMSEFQEAHTVSTLKGAPPGYIGYGEGGVLTEAVRRKPYSVVLLDEVEKAHPDVHEIFFQVFDKGVMEDGEGRVIDFKNTLILLTTNAGTEMIASLCADPELMPEPEAIAKSLREPLLKIFPPALLGRLVTIPYYPLSDDMLKAISRLQLGRIKKRVEATHKVPFEFDEGVVDLIVSRCTETESGGRMIDAILTNTLLPDMSREFLTRMLEGKPLAGVRISSRDNQFHYDFAEAE
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: clpV1 mutant is attenuated in rats (Potvin et al., 2003).
COG COG0542O, under O: Posttranslational modification, protein turnover, chaperones
References
Potvin et al., 2003: Potvin E, Lehoux DE, Kukavica-Ibrulj I, Richard KL, Sanschagrin F, Lau GW, Levesque RC. In vivo functional genomics of Pseudomonas aeruginosa for high-throughput screening of new virulence factors and antibacterial targets. Environmental microbiology. 2003; 5(12); 1294-1308. [PubMed: 14641575].