Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

relA

Victor ID 4255
Gene Name relA
Sequence Strain (Species/Organism) Pseudomonas aeruginosa PAO1
NCBI Gene ID 881299
NCBI Protein GI 15596131
Locus Tag PA0934
Protein Accession NP_249625.1
Other Database IDs UniProtKB-ID: Q9I524_PSEAE
UniRef100: UniRef100_B7UY00
UniRef90: UniRef90_B7UY00
UniRef50: UniRef50_A6VUQ3
UniParc: UPI00000C51C6
EMBL: AE004091
EMBL-CDS: AAG04323.1
RefSeq_NT: NC_002516.2
GenomeReviews: AE004091_GR
KEGG: pae:PA0934
PseudoCAP: PA0934
HOGENOM: HBG594146
OMA: DLGHRCR
ProtClustDB: CLSK866228
BioCyc: PAER208964:PA0934-MONOMER
Taxonomy ID 208964
Gene Starting Position 1023052
Gene Ending Position 1025295
Gene Strand (Orientation) +
Protein Name GTP pyrophosphokinase
DNA Sequence
>gi|110645304:1023052-1025295 Pseudomonas aeruginosa PAO1 chromosome, complete genome
GATGGTACAGGTGAGAGCGCACCAGCCGGTCAACACCGACGGCAGTATCAACCTCGAGGCCTGGCTGGAC
CACGTCCAGAACCTCGTCCCCGGGCTCGATCGTCAGGGCTTGCTGGAGGCTTGCGAGTTCGCTCGCGAAT
CCGAGCAGCGAGCGATCGCCGCACAGAACTCCTGGGCGGAAGGCACGTCCAGCTTCCAGACCGGACTGGA
AATCGCCGAGATCCTCGCGGATCTCAAGCTGGATCAGGAGTCCCTGGTCGCCGCGGTCATCTATCGAGGC
GTGCGGGAAGGCAAGATCACCCTGGAAGCGGTCAACAAGCATTTCGGGCCGGTGGTGGCCAAGCTGATCG
AGGGCGTGCTGCGCATGGCCGCGATCAGCGCCAGCCTCAATCCGCGCCATTCCATGGTGCTGGGTACCCA
GGCGCAGGTGGAGAACCTGCGCAAGATGCTGGTGGCGATGGTCGACGACGTTCGCGTCGCCCTGATCAAG
CTGGCCGAGCGCACCTGCGCCATTCGCGCGGTGAAGAACGCCGACGAGGAAAAGCGCCACCGCGTCGCCC
GGGAAGTCTTCGATATCTACGCGCCGCTGGCCCACCGCCTGGGCATCGGGCATATCAAGTGGGAGCTGGA
GGACCTGTCCTTCCGTTACCTCGAGCCCGACCAGTACAAGCAGATCGCCAAGCTGCTGCACGAGCGCCGG
CTGGATCGTGAGCAGTACATCGCCAACGTGATGAGCCAGTTGAAGGAAGCTCTCGCGGCCACCGGCGTAC
AGGCCGATCTCAGCGGACGGGCGAAACACATCTATTCGATCTGGCGCAAGATGCAGCGCAAGGGCCTGGA
CTTCAGCCAGATCTACGACGTTCGCGCCGTGCGCGTGCTCGTTCCGGAGATGCGCGACTGCTACACCGCG
CTGGGCATCGTGCATACCCTCTGGCGGCACATTCCCAAGGAGTTCGACGACTACATCGCCAACCCCAAGG
AAAACGGCTATCGCTCGCTGCATACCGCAGTGATCGGCCCCGAGGGGAAGGTGCTGGAAGTACAGATCCG
TACCCACTCCATGCACGAAGAGGCGGAGCTCGGAGTCTGCGCGCACTGGCGCTACAAGGGGACCGACGTC
AAGGCCAGCTCCAACCATTACGAGGAAAAGATCTCCTGGCTGCGCCAGGTGCTCGAATGGCACGAGGAAC
TGGGCGACATCGGTGGCCTGGCGGAGCAACTGCGGGTCGATATCGAGCCGGACAGGGTCTACGTCTTCAC
TCCCGACGGCCATGCCATCGACCTGCCCAAGGGCGCGACCCCGCTGGATTTCGCCTATCGGGTCCACACT
GAAGTCGGGCACAACTGCCGCGGGGCGAAGATCAACGGACGCATCGTGCCGCTGAACTACAGCCTGCAGA
CCGGCGAGCAGGTCGAGATCATAACCGGCAAGCACAGCGGTCCGAGCCGCGACTGGCTGAACAGCAACCT
GGGCTACGTCACCACCTCCCGGGCGCGGGCGAAGATCGTCCACTGGTTCAAGCTGCAGGCGCGGGACCAG
AACGTCGCTGCCGGCAAGGCCCTGATCGAACGCGAGCTGTCGCGCCTGGCGCTGCCGCCGGTGGATTTCG
ACCGGCTGGCGGAGAAGGCCAACGTGCGTACCGCCGAGGATATGTTCGCCGCTCTCGGCGCCGGCGACCT
GCGCTTGGCGCACCTGGTCAACTATGCCCAGCAACTGGTCGAGCCGGACCGCGACAGCGAGCAACTCGAA
CTGATCCCGCGCAAGCCGAGCAAGATCGGCCACGGCAAGCGCGGCGACGTGCAGATCCAGGGTGTCGGCA
ACCTCCTGACGCAGATGGCCGGCTGCTGCCAGCCGCTGCCGGGAGATCCCATCGTCGGCTACATCACGCT
GGGCCGTGGGGTCACCATCCACCGCCAGGATTGCGCCACCGCGCTGCAACTGGCGGGACGCGAACCGGAG
CGGATGATCCAGGTCAGCTGGGGGCCGGAGCCGGTTCGCACCTATCCGGTGGATATCGCGATCCGTGCCT
ATGATCGTTCCGGCCTGTTGCGCGACGTGTCCCAGGTGCTGCTCAACGAGCGGATCAACGTTCTGGCGGT
GAATACCCGTTCGAACAAGGAAGACAACACCGCGACCATGCAACTGACCATCGAGATTCCCGGTCTGGAC
GCTCTTGGACGCCTGCTGGCGCGCGTCTCGCAACTGCCCAACATCATCGAGGCGCGGCGCAACCGTACGC
CTTG
Protein Sequence
>gi|15596131|ref|NP_249625.1| GTP pyrophosphokinase [Pseudomonas aeruginosa PAO1] MVQVRAHQPVNTDGSINLEAWLDHVQNLVPGLDRQGLLEACEFARESEQRAIAAQNSWAEGTSSFQTGLEIAEILADLKLDQESLVAAVIYRGVREGKITLEAVNKHFGPVVAKLIEGVLRMAAISASLNPRHSMVLGTQAQVENLRKMLVAMVDDVRVALIKLAERTCAIRAVKNADEEKRHRVAREVFDIYAPLAHRLGIGHIKWELEDLSFRYLEPDQYKQIAKLLHERRLDREQYIANVMSQLKEALAATGVQADLSGRAKHIYSIWRKMQRKGLDFSQIYDVRAVRVLVPEMRDCYTALGIVHTLWRHIPKEFDDYIANPKENGYRSLHTAVIGPEGKVLEVQIRTHSMHEEAELGVCAHWRYKGTDVKASSNHYEEKISWLRQVLEWHEELGDIGGLAEQLRVDIEPDRVYVFTPDGHAIDLPKGATPLDFAYRVHTEVGHNCRGAKINGRIVPLNYSLQTGEQVEIITGKHSGPSRDWLNSNLGYVTTSRARAKIVHWFKLQARDQNVAAGKALIERELSRLALPPVDFDRLAEKANVRTAEDMFAALGAGDLRLAHLVNYAQQLVEPDRDSEQLELIPRKPSKIGHGKRGDVQIQGVGNLLTQMAGCCQPLPGDPIVGYITLGRGVTIHRQDCATALQLAGREPERMIQVSWGPEPVRTYPVDIAIRAYDRSGLLRDVSQVLLNERINVLAVNTRSNKEDNTATMQLTIEIPGLDALGRLLARVSQLPNIIEARRNRTP
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: relA mutant is attenuated in D. melanogaster (Erickson et al., 2004).
COG COG0317TK, under T: Signal transduction mechanisms; K: Transcription
References
Erickson et al., 2004: Erickson DL, Lines JL, Pesci EC, Venturi V, Storey DG. Pseudomonas aeruginosa relA contributes to virulence in Drosophila melanogaster. Infection and immunity. 2004; 72(10); 5638-5645. [PubMed: 15385461].