Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

algU

Victor ID 4262
Gene Name algU
Sequence Strain (Species/Organism) Pseudomonas aeruginosa PAO1
NCBI Gene ID 882125
NCBI Protein GI 15595959
Locus Tag PA0762
Protein Accession NP_249453.1
Other Database IDs UniProtKB-ID: RPSH_PSEAE
UniRef100: UniRef100_Q06198
UniRef90: UniRef90_Q06198
UniRef50: UniRef50_Q06198
UniParc: UPI000013484A
EMBL: U49151
EMBL: L14760
EMBL: L14761
EMBL: L36379
EMBL: AE004091
EMBL: U17232
EMBL-CDS: AAC43714.1
EMBL-CDS: AAA87628.1
EMBL-CDS: AAA87631.1
EMBL-CDS: AAA64439.1
EMBL-CDS: AAG04151.1
EMBL-CDS: AAA92355.1
RefSeq_NT: NC_002516.2
GenomeReviews: AE004091_GR
KEGG: pae:PA0762
PseudoCAP: PA0762
HOGENOM: HBG753452
OMA: EQLRDIN
ProtClustDB: PRK11923
BioCyc: PAER208964:PA0762-M
Taxonomy ID 208964
Gene Starting Position 831300
Gene Ending Position 831881
Gene Strand (Orientation) +
Protein Name RNA polymerase sigma factor AlgU
DNA Sequence
>gi|110645304:831300-831881 Pseudomonas aeruginosa PAO1 chromosome, complete genome
CATGCTAACCCAGGAACAGGATCAGCAACTGGTTGAACGGGTACAGCGCGGAGACAAGCGGGCTTTCGAT
CTGCTGGTACTGAAATACCAGCACAAGATACTGGGATTGATCGTGCGGTTCGTGCACGACGCCCAGGAAG
CCCAGGACGTAGCGCAGGAAGCCTTCATCAAGGCATACCGTGCGCTCGGCAATTTCCGCGGCGATAGTGC
TTTTTATACCTGGCTGTATCGGATCGCCATCAACACCGCGAAGAACCACCTGGTCGCTCGCGGGCGTCGG
CCACCGGACAGCGATGTGACCGCAGAGGATGCGGAGTTCTTCGAGGGCGACCACGCCCTGAAGGACATCG
AGTCGCCGGAACGGGCGATGTTGCGGGATGAGATCGAGGCCACCGTGCACCAGACCATCCAGCAGTTGCC
CGAGGATTTGCGCACGGCCCTGACCCTGCGCGAGTTCGAAGGTTTGAGTTACGAAGATATCGCCACCGTG
ATGCAGTGTCCGGTGGGGACGGTACGGTCGCGGATCTTCCGCGCTCGTGAAGCAATCGACAAAGCTCTGC
AGCCTTTGTTGCGAGAAGCCTG
Protein Sequence
>gi|15595959|ref|NP_249453.1| RNA polymerase sigma factor AlgU [Pseudomonas aeruginosa PAO1] MLTQEQDQQLVERVQRGDKRAFDLLVLKYQHKILGLIVRFVHDAQEAQDVAQEAFIKAYRALGNFRGDSAFYTWLYRIAINTAKNHLVARGRRPPDSDVTAEDAEFFEGDHALKDIESPERAMLRDEIEATVHQTIQQLPEDLRTALTLREFEGLSYEDIATVMQCPVGTVRSRIFRAREAIDKALQPLLREA
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: algU mutant is attenuated in rats (Potvin et al., 2003).
COG COG1595K, under K: Transcription
References
Potvin et al., 2003: Potvin E, Lehoux DE, Kukavica-Ibrulj I, Richard KL, Sanschagrin F, Lau GW, Levesque RC. In vivo functional genomics of Pseudomonas aeruginosa for high-throughput screening of new virulence factors and antibacterial targets. Environmental microbiology. 2003; 5(12); 1294-1308. [PubMed: 14641575].