Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

PA0158

Victor ID 4263
Gene Name PA0158
Sequence Strain (Species/Organism) Pseudomonas aeruginosa PAO1
NCBI Gene ID 882140
NCBI Protein GI 15595356
Locus Tag PA0158
Protein Accession NP_248848.1
Other Database IDs UniProtKB-ID: Q9I6X4_PSEAE
UniRef100: UniRef100_B7V276
UniRef90: UniRef90_B7V276
UniRef50: UniRef50_B0UEB3
UniParc: UPI00000C4F6D
EMBL: AE004091
EMBL-CDS: AAG03548.1
RefSeq_NT: NC_002516.2
HSSP: P31224
TCDB: 2.A.6.2.27
GenomeReviews: AE004091_GR
KEGG: pae:PA0158
PseudoCAP: PA0158
HOGENOM: HBG677732
OMA: FTSALFE
ProtClustDB: CLSK865642
BioCyc: PAER208964:PA0158-MONOMER
Taxonomy ID 208964
Gene Starting Position 179521
Gene Ending Position 182568
Gene Strand (Orientation) +
Protein Name resistance-nodulation-cell division family transporter
DNA Sequence
>gi|110645304:179521-182568 Pseudomonas aeruginosa PAO1 chromosome, complete genome
GATGAAGGGCGGTTTCAACCTGTCGGACTGGGCCCTGCGCCACCAGTCCCTGGTCTGGTACCTGATGGCG
GTATCGCTGGTGATGGGCGTGTTCTCCTACCTCAACCTGGGGCGCGAGGAGGATCCCTCGTTCGCCATCA
AGACCATGGTCATCCAGACCCGCTGGCCGGGCGCCACGGTGGACGACACCCTGGAGCAGGTCACCGACCG
CATCGAGAAGAAGCTCGAGGAGCTGGACTCGCTGGATTACGTGAAGAGCTACACGCGACCCGGCGAATCG
ACGGTCTTCGTCTACCTCAAGGACACCACCAAGGCCGGCGACATCCCGGATATCTGGTACCAGGTGCGCA
AGAAGATATCCGACATCCAGGGCGAATTCCCCCAGGGCATCCAGGGACCGGGTTTCAACGACGAGTTCGG
CGACGTGTTCGGCAGCGTCTACGCCTTCACCGCCGATGGCCTGGACTTCCGCCAGCTGCGCGACTACGTG
GAGAAGGTGCGCCTGGACATCCGCTCGGTGAAAGACCTGGGCAAGGTGCAGATGATCGGTGCGCAGAACG
AGGTCATCTACCTCAACTTCTCTACCCGCAAGCTGGCCGCCCTCGGTCTCGACCAGCGCCAGGTCGTGCA
GAGCCTGCAGGCGCAGAACGCGGTGACCCCGTCCGGCGTGGTCGAGGCCGGCCCCGAGCGCATCTCGGTG
CGCACCTCCGGCAACTTCCGTTCGGAAAAGGACCTGCAGGCGGTCAACCTGCGGGTCAACGATCGTTTCT
ACCGGCTGTCCGACCTGGCCAGCATCAGCCGCGATTTCGTCGACCCGCCGACCTCGCTGTTCCGCTACAA
GGGCGAGCCGGCCATCGGCCTGGCGGTGGCGATGAAGGAGGGCGGCAATATCCTCGAGTTCGGCGAGGCG
CTCAATGCGCGCATGCAGGAGATCACCGGCGAACTGCCGGTTGGCGTCGGCGTGCACCAGGTGTCGAACC
AGGCCCAGGTGGTGAAGAAGGCGGTCGGCGGTTTCACCCGGGCGCTGTTCGAGGCGGTGGTGATCGTCCT
CATCGTCAGCTTCGTCAGCCTCGGCCTGCGCGCCGGGCTGGTGGTGGCCTGCTCGATCCCGCTGGTGCTG
GCGATGGTCTTCGTGTTCATGGAATACACCGACATCACCATGCAGCGGGTTTCCCTCGGCGCGCTGATCA
TCGCCCTCGGCCTGCTGGTGGACGATGCCATGATCACCGTGGAGATGATGATCACGCGCCTCGAACTGGG
CGACTCGCTACACGACTCGGCGACCTACGCCTACACCTCGACGGCCTTCCCGATGCTCACCGGGACCCTG
GTGACGGTGGCCGGCTTCGTACCCATCGGGCTCAACGCCAGCTCCGCCGGCGAGTACACCTTCACCCTGT
TCGCAGTGATCGCCGTGGCGCTGCTGCTGTCGTGGATCGTCGCGGTGCTGTTCGCCCCGGTGATCGCCGT
GCACATCCTGCCGAAGACTCTCAAGCACAAGTCGGAGCAGAAGAAGGGCCGCATTGCCGAGCGTTTCGAC
AGCCTGCTGCACCTGGCGATGCGCCGGCGCTGGACGACCATCTTCCTCACCGCGCTGCTGTTCGGCGTGT
CGCTGTTCCTGATGAAGTTCGTCCAGCACCAGTTCTTCCCGTCTTCCGACCGTCCGGAACTGCTGGTCGA
CCTCAACCTGCCGCAGAACAGCAGCATCCACGAGACCAGGGCGGTGATGGACCGCCTGGAAGCGACGCTG
AAGGACGACGAGGACATCGACCACTGGAGCGCCTACGTCGGCGAAGGCGCGATCCGCTTCTACCTGCCGC
TGGACCAGCAGTTGCAGAACAACTTCTATGGCCAGCTGGTGATCGTCACCAAGGACCTGGAGGCCCGCGA
GCGCGTCGCCGCACGCCTGCGCGATCGCTTGCGCAAGGACTACGTCGGCATCAGCACCTACGTGCAGCCG
CTGGAGATGGGGCCGCCGGTGGGACGGCCGATCCAGTACCGGGTCAGCGGACCGCAGATCGACAAGGTCC
GCGAGTACGCCATGGGCCTGGCCGGCGTGCTCGACGGCAACCCGAACATCGGCGATATCGTCTACGACTG
GAACGAGCCCGGGAAGATGCTCAAGATCGACATCGCCCAGGACAAGGCGCGCCAGCTCGGGCTTTCCTCC
GAGGACGTGGCGCAGATCATGAACAGCGTGGTGACCGGCAGCGCGGTGACCCAGGTGCGCGACGACATCT
ACCTGGTGAACGTCATCGGCCGCGCCGAGGATAGCGAGCGCGGCTCGCTGGAGACCCTGGAGAGCCTGCA
GATCGTCACGCCCAGCGGCACCTCGATCCCGCTCAAGGCGTTCGCCAAGGTCAGCTACGAGCTGGAGCAG
CCGCTGGTGTGGCGCCGCGACCGCAAGCCGACGATCACGGTGAAGGCGTCGCTGCGCGGCGAGATCCAGC
CCACCGACCTGGTCGCCCGGCTGGCGCCGGAGGTCAAGCGCTTCGCCGACGGCCTGCCGGCGAACTACCG
GATCGAAGTGGGCGGCACGGTGGAGGAGAGCGGCAAGGCCGAGGGCCCGATCGCCAAGGTGGTGCCGCTG
ATGCTGTTCCTCATGGCGACCTTCCTGATGATCCAGTTGCAGAGCGTGCAGAAGCTATTCCTGGTGGCCA
GCGTCGCGCCGCTGGGGCTGATCGGGGTGGTCGCGGCGTTGCTGCCGACCGGCACGCCGATGGGCTTCGT
GGCGATCCTCGGGATTCTCGCGCTGATCGGCATCATCATCCGCAACTCGGTGATCCTGGTGACCCAGATC
GATGCCTTCGAGAAAGACGGCAAGACGCCCTGGGAAGCCGTGCTGGAAGCCACCCACCACCGCACCCGGC
CGATCCTGCTGACGGCGGCGGCGGCCAGCCTGGGGATGATCCCCATCGCCCGCGAAGTGTTCTGGGGGCC
GATGGCCTATGCGATGATCGGCGGCATCGTCGCCGCCACGCTGCTCACGCTGATCTTCCTGCCGGCGCTG
TACGTCGCCTGGTACCGGATTCCGGAACCGGGACGCTG
Protein Sequence
>gi|15595356|ref|NP_248848.1| resistance-nodulation-cell division (RND) efflux transporter [Pseudomonas aeruginosa PAO1] MKGGFNLSDWALRHQSLVWYLMAVSLVMGVFSYLNLGREEDPSFAIKTMVIQTRWPGATVDDTLEQVTDRIEKKLEELDSLDYVKSYTRPGESTVFVYLKDTTKAGDIPDIWYQVRKKISDIQGEFPQGIQGPGFNDEFGDVFGSVYAFTADGLDFRQLRDYVEKVRLDIRSVKDLGKVQMIGAQNEVIYLNFSTRKLAALGLDQRQVVQSLQAQNAVTPSGVVEAGPERISVRTSGNFRSEKDLQAVNLRVNDRFYRLSDLASISRDFVDPPTSLFRYKGEPAIGLAVAMKEGGNILEFGEALNARMQEITGELPVGVGVHQVSNQAQVVKKAVGGFTRALFEAVVIVLIVSFVSLGLRAGLVVACSIPLVLAMVFVFMEYTDITMQRVSLGALIIALGLLVDDAMITVEMMITRLELGDSLHDSATYAYTSTAFPMLTGTLVTVAGFVPIGLNASSAGEYTFTLFAVIAVALLLSWIVAVLFAPVIAVHILPKTLKHKSEQKKGRIAERFDSLLHLAMRRRWTTIFLTALLFGVSLFLMKFVQHQFFPSSDRPELLVDLNLPQNSSIHETRAVMDRLEATLKDDEDIDHWSAYVGEGAIRFYLPLDQQLQNNFYGQLVIVTKDLEARERVAARLRDRLRKDYVGISTYVQPLEMGPPVGRPIQYRVSGPQIDKVREYAMGLAGVLDGNPNIGDIVYDWNEPGKMLKIDIAQDKARQLGLSSEDVAQIMNSVVTGSAVTQVRDDIYLVNVIGRAEDSERGSLETLESLQIVTPSGTSIPLKAFAKVSYELEQPLVWRRDRKPTITVKASLRGEIQPTDLVARLAPEVKRFADGLPANYRIEVGGTVEESGKAEGPIAKVVPLMLFLMATFLMIQLQSVQKLFLVASVAPLGLIGVVAALLPTGTPMGFVAILGILALIGIIIRNSVILVTQIDAFEKDGKTPWEAVLEATHHRTRPILLTAAAASLGMIPIAREVFWGPMAYAMIGGIVAATLLTLIFLPALYVAWYRIPEPGR
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: PA0158 mutant is attenuated in rats (Lehoux et al., 2002).
COG COG0841V, under V: Defense mechanisms
References
Lehoux et al., 2002: Lehoux DE, Sanschagrin F, Levesque RC. Identification of in vivo essential genes from Pseudomonas aeruginosa by PCR-based signature-tagged mutagenesis. FEMS microbiology letters. 2002; 210(1); 73-80. [PubMed: 12023080].