Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

exoT from Pseudomonas aeruginosa UCBPP-PA14

Victor ID 4411
Gene Name exoT from Pseudomonas aeruginosa UCBPP-PA14
Sequence Strain (Species/Organism) Pseudomonas aeruginosa UCBPP-PA14
NCBI Gene ID 4381738
NCBI Protein GI 116053766
Locus Tag PA14_00560
Protein Accession YP_788201.1
Other Database IDs UniProtKB-ID: Q02V35_PSEAB
UniRef100: UniRef100_Q02V35
UniRef90: UniRef90_B7V0T1
UniRef50: UniRef50_Q93Q17
UniParc: UPI0000E44880
EMBL: CP000438
EMBL-CDS: ABJ15002.1
RefSeq_NT: NC_008463.1
GenomeReviews: CP000438_GR
KEGG: pau:PA14_00560
NMPDR: fig|208963.3.peg.4285
eggNOG: NOG149636
HOGENOM: HBG298842
OMA: TNGEYQH
ProtClustDB: CLSK689870
BioCyc: PAER208963:PA14_00560-MONOMER
Taxonomy ID 208963
Gene Starting Position 57147
Gene Ending Position 58475
Gene Strand (Orientation) +
Protein Name exoenzyme T
DNA Sequence
>gi|116048575:57147-58475 Pseudomonas aeruginosa UCBPP-PA14, complete genome
CATGCATATTCAATCATCTCAGCAGAACCCGTCTTTCGTGGCTGAGTTGAGCCAGGCCGTGGCCGGGCGC
CTGGGACAGGTCGAGGCCCGCCAGGTGGCCACTCCCCGGGAGGCGCAACAACTGGCCCAGCGCCAGGAAG
CACCGAAGGGCGAGGGCCTGCTCTCCCGCCTGGGGGCTGCCCTCGCGCGTCCCTTCGTGGCGATCATCGA
GTGGCTGGGCAAACTGCTGGGGAGCCGTGCCCACACCGCCACCCAGGCGCCGCTCTCCCGTCAGGACGCG
CCGCCTGCCGCCAGTCTCTCGGCCGCCGAGATCAAGCAGATGATGCTGCAAAAGGCACTGCCCCTGACCT
TGGGCGGACTTGGCAAGGCGAGCGAGCTGGCGACTTTGACAGAGGAGAGACTGGCGAAGGATCACACGCG
CCTGGCCAGCGGCGACGGCGCCCTGCGCTCGCTGGCCACCGCCCTGGTCGGGATTCGCGATGGCAGCCGG
ATCGAGGCTTCCCGTACCCAGGCTGCCCGCCTGCTCGAACAGAGCGTTGGGGGGATCGCGCTGCAACAGT
GGGGGACCGCGGGCGGTGCCGCCAGCCAGCATGTACTCAGCGCAAGCCCGGAGCAACTGCGCGAAATCGC
CGTCCAACTGCATGCGGTAATGGACAAGGTCGCCCTGTTGCGCCACGCGGTAGAGAGCGAGGTAAAGGGC
GAGCCTGTCGACAAGGCGCTGGCGGATGGCCTGGTGGAGCACTTCGGGCTGGAGGCGGAGCAGTACCTCG
GCGAACACCCGGACGGGCCGTACAGCGATGCCGAGGTGATGGCGCTCGGTCTCTATACCAACGGCGAGTA
CCAGCACCTGAATCGTTCCCTGCGTCAGGGACGGGAGCTGGATGCGGGCCAGGCGTTGATCGACCGGGGC
ATGTCTGCCGCGTTCGAAAAGAGCGGACCGGCTGAACAGGTCGTGAAGACCTTCCGCGGCACCCAGGGCA
GGGATGCCTTCGAGGCGGTGAAAGAGGGCCAGGTCGGCCACGACGCCGGCTATCTCTCCACCTCCCGGGA
CCCCGGCGTTGCCAGGAGCTTCGCGGGCCAGGGCACGATAACCACCCTGTTCGGCAGATCCGGGATCGAT
GTCAGCGAGATATCGATCGAGGGCGATGAGCAGGAGATCCTCTACGACAAGGGGACCGACATGCGCGTAC
TGCTCAGCGCCAAGGATGGGCAGGGTGTGACCCGTCGGGTGCTCGAAGAGGCCACGCTGGGGGAACGGAG
CGGCCACGGCGAGGGACTGCTCGATGCCCTGGACCTGGCAACCGGGACGGATCGTTCAGGCAAGCCCTA
Protein Sequence
>gi|116053766|ref|YP_788201.1| exoenzyme T [Pseudomonas aeruginosa UCBPP-PA14] MHIQSSQQNPSFVAELSQAVAGRLGQVEARQVATPREAQQLAQRQEAPKGEGLLSRLGAALARPFVAIIEWLGKLLGSRAHTATQAPLSRQDAPPAASLSAAEIKQMMLQKALPLTLGGLGKASELATLTEERLAKDHTRLASGDGALRSLATALVGIRDGSRIEASRTQAARLLEQSVGGIALQQWGTAGGAASQHVLSASPEQLREIAVQLHAVMDKVALLRHAVESEVKGEPVDKALADGLVEHFGLEAEQYLGEHPDGPYSDAEVMALGLYTNGEYQHLNRSLRQGRELDAGQALIDRGMSAAFEKSGPAEQVVKTFRGTQGRDAFEAVKEGQVGHDAGYLSTSRDPGVARSFAGQGTITTLFGRSGIDVSEISIEGDEQEILYDKGTDMRVLLSAKDGQGVTRRVLEEATLGERSGHGEGLLDALDLATGTDRSGKP
Molecule Role Virulence factor
Molecule Role Annotation TOXIN: exoT interferes with Rho signal transduction pathways, which regulate actin organization, exocytosis, cell cycle progression, and phagocytosis (Krall et al., 2000).
COG COG5585T, under T: Signal transduction mechanisms
References
Krall et al., 2000: Krall R, Schmidt G, Aktories K, Barbieri JT. Pseudomonas aeruginosa ExoT is a Rho GTPase-activating protein. Infection and immunity. 2000; 68(10); 6066-6068. [PubMed: 10992524].