Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

lbtA

Victor ID 4459
Gene Name lbtA
Sequence Strain (Species/Organism) Legionella pneumophila 130b
NCBI Nucleotide GI 71726458
NCBI Protein GI 71726459
Protein Accession AAZ39407.1
Taxonomy ID 866628
Gene Strand (Orientation) ?
Protein Name legiobactin biosynthesis protein A
Protein Note serogroup: 1
DNA Sequence
>gi|71726458|gb|DQ118422.1| Legionella pneumophila strain Wadsworth 130b legiobactin biosynthesis protein A (lbtA) gene, partial cds
ATGGCAGCAGTTTTAAATAATTCTTATAAAATAAATAACTCATTACACAGTTTATTACTTGAAAAAGACC
TTCTTGTTTCACAATCAGAAATGGAGCATTTCATATCCATTGCGCACCAGCAATGTTTAGATCGATTGCA
ACAGGCAGCACTTCGTGAAGGATTAATAGATAAGGAAATAACCAGCCTTCATATACATGATTATCTTGAT
TTACTTTATCATCAACAGAAAAAGCAAAAACCGGAAAAAACATTTGATCGATGGCCTCTTCTAAAAAAGG
AACTCGATGAAAGCATCAACAATCAGGCGTTAGCCCTCGCTTATTATCATTGCTGGCAACAATCGCTGAA
GCAACAGGCGAAAAACCACTCCAGTTTATGGTCATGGTTATCAGAGCAACATAATAAACAACAAATTCTG
ACTTTTTTAGAGCAATGGGGTTGCATAGGGCACCCGTATCATCCTAATTTCCGCGCAAAAATGGGGTTTA
TTCCTGAAGAAGTGATTCGATACTCCCCAGAATTTAACGCGCAGGTAGATATTCCCTGGCTGGCAATTCA
TCGCTCCTTAGCGTTTACTTCAATTGATGCGACTAGCTATTCTTTGTTGTTTGCCCAACATTTTGCTAAA
GAATATCAATTGTGGAATTATTCTGTCCAAAAACAACAATTAGATCCCGAACAGTATTTGCCTCTTCCAG
TTCATCCCTGGCAATGGAATAACAAATTACAAACACTGGCCTCAGTATTAATCAATTCAAAGCAATTATT
AATAACAGAGGCTTTTCAAAAAACCAAACCATCCATGTCGTTCCGAACGATGATGCCTTTAGATAACAAA
GGTCCACACTTAAAATTAGCTACAGCAATCCATACTACTTCTGCTTTACGCACTGTATCTCCTGCATCAG
TAAGCAATTCATCTCCTCTTTCCAGTTGGCTTAGGCAATTACTGACTCAGTATCAAAGTTTTGAAAAGCC
ACTATTTCTAGCCAGGGATTTAGCAGGGATTAACACCACACACACATCCATTTCTCCACAAAATAAAAAG
CATTTGGCTATGATAGTACGTGAAAATCCACTGGAATTGATCGATGCGTCACAAACATTAGTACCTTTAG
CTGCTCTCTATGCTCTTTCTCCAGTCAGTCAACGTGCTTTATTCATTGAAATTATTGAAGCAAGTGGCAT
GGAGCCTGAATTATATTTTATTGAATACAGCCGATGTATTCTCGAATGCCAGCTTCATTTATTATTAAGC
TATGGCGTTGCGTTGGAAGCCCAACAACAAAACACTTTAGTCATTTTTCAGTCTCATCGGCCTGTTGGAT
TAGTTATTCGAGATCTTGGCGGCATCAGGGTCTGTTTTAATTCGCTATATGAGACAACACCCAAACCTAA
TCTTCATCCAGACTCTACCATTTCATGCCACGAATTGAGTGATCTCTTTAATACCTTCATTTATGGAAAT
TTACTGAGTAACTTAACTTTTTGCATTAATTGTTTACATGATAACTATAACTTGAATAAAAAAAACCTTT
GGATCCTGCTAAAACAAATTGCAAATCAATTATTACAAAATTTTAAAAAGGAAATTAATCCATTGATATA
CCAAAAATTCCAACAACATTTATTCTCTCTTCCCTGGCAACATAAAAGTTTGCTGAGCATGAGACTCAAT
CAAAATCAGGATAACCTGGTATTTTTTAGTCTTGACAACCCATTGAGCCAAGATAATGAA

Molecule Role Virulence factor
Molecule Role Annotation MUTATION: lbtA mutant displayed a reduced ability to infect the lungs of A/J mice after intratracheal inoculation
(Allard et al., 2009).
References
Allard et al., 2009: Allard KA, Dao J, Sanjeevaiah P, McCoy-Simandle K, Chatfield CH, Crumrine DS, Castignetti D, Cianciotto NP. Purification of Legiobactin and importance of this siderophore in lung infection by Legionella pneumophila. Infection and immunity. 2009; 77(7); 2887-2895. [PubMed: 19398549].