Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

milA

Victor ID 4460
Gene Name milA
Sequence Strain (Species/Organism) Legionella pneumophila AA100
NCBI Nucleotide GI 5702298
NCBI Protein GI 5702299
Protein Accession AAD47247.1
Taxonomy ID 446
Gene Strand (Orientation) ?
Protein Name putative transport protein
Protein Note similar to Bacillus subtilis hypothetical 48.2 kDa protein in cotF-tetB intergenic region: SwissProt Accession Number P37489
DNA Sequence
>gi|5702298|gb|AF153695.1| Legionella pneumophila putative transport protein gene, complete cds
TTGAAATTTTATCTCTAACCTGAAGCAAATAAGTTAGGAGTTATTGTGAACACATTGTCATTCAAGCATC
CATTGCTGGCTAAAACTTATCTTTGGATTATATGGACCATCGCGGCATGTTTTTTCTTTTATAAATATTT
GATTCAGGTTTCTCCCAGTGTTATGACAGCTGACTTGATGAAGGCATTTCAGGTTAATGCGGCTGGTCTT
GGGAATTTGTCAGCCTTTTATTTTTATTCCTATTTATTTATGCAGATTCCTGTGGGTGTTATGTTAGACA
GGTATAGTCCAAGATTACTGACGACCCTTGCTATTTTTGTCTGTAGTATCAGTACTTATATTTTTTCCCA
AACCAATACTTTATGGTTGGCCTGCCTAAGTCGAGCATTGATGGGGGCGGGAGCGGCTTTTGCTGCTGTG
TCTTGTTTTAAGCTAGCCGCTGTCTGGTTTTCTCCAAAACGATTTGCTCTAGTATCAGGGATGTTTATGA
CAGCAGCTATGCTGGGTGCTGTGGGAGGGCAGATGCCTTTGGCATTTTTGGTTCAACATGAAGGTTGGCG
CAAGGCGCTTGAATTAGTTAGCGTGATGGGGATTATCCTGGGGGTCGTGTATTTTCTCATTTTAAGAGAT
AAGCCTGCACAAACGCAGCCTATGCCAAATAGCAAGGAACCTGTTATTCAATTGTTAAGACGTATTATCG
TTAATAAGCAGGCCTGGGCTTTGTCTTTATATAGTGGATTAGCATTTGCTCCTGTTTCGGTTTTTGGTGG
ATTATGGGGAGTTCCTTTTTTGGAAAAGGCCTATCTCTTATCTCGTACTGATGCAGCCCTTGCGATTTCA
TTTATTTTTGTCGGTTTTGCGGCAGGCGCGCCATTTTGGGGATGGTTTTCTGATTTTATCAGGCGGAGAA
AGCCTGTTTTGTTTACAGGAACGTGTTCTGCTCTATTGTGTTTATTGGTAGTTATTTATAGCTCAAACCA
AAATTTGCTTACTTTAATTATTCTTTTATTTCTCTTTGGTTTTGGAGCGAGTGGATTTTTTACCAGCTTT
GCAATGATCAGGGAATTATTTCCTTTGGTACTTGTAGCGACAGTACTTGGTATTATGAATACGTTTAATT
CGGTGTTTGAGGCTTTGTTTGAGCCACTGGTTGGTGCTTTGCTGGATTGGACATGGGAGGGGACCATGGT
GGATGGTATTCATCAATTTACTTTACACGGGTACTATTTTTCTCTTTTATTGTTGCCTCTATCTTTAATT
TTAGCCTTATTGACCTTGTTATTGATTGATGAAACCTATTGTCGAACAAAGGAGGAGGTAGTGTAAACCT
CCTTATTATTGATTGCAGGTTATTTTTTGAGGCAGGAAACCATATGGGCCTTTTGCGTTTGGATTAAAAA
ATCACAGTACATCCTTTTGTTTTTTGAGGCAATTGTTGTGTCAGTTCAATTCCTGTTTGATTGTAATGAC
ACACAATGTAAATGGTATCATGAGGAGAAAACTTCCATTCGGCTTTTTTCTTATTGATACGGTTTGGTT

Molecule Role Virulence factor
Molecule Role Annotation MUTATION: milA mutant is defective in intracellular replication in macrophages (Harb and Abu, 2000).
References
Harb and Abu, 2000: Harb OS, Abu Kwaik Y. Characterization of a macrophage-specific infectivity locus (milA) of Legionella pneumophila. Infection and immunity. 2000; 68(1); 368-376. [PubMed: 10603410].