Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

CHS2

Victor ID 4824
Gene Name CHS2
Sequence Strain (Species/Organism) Exophiala dermatitidis wild strain 8656
NCBI Nucleotide GI 3548903
NCBI Protein GI 3548904
Protein Accession AAC34496.1
Taxonomy ID 5970
Gene Strand (Orientation) ?
Protein Name chitin synthase 2
Protein Note class I chitin synthase
DNA Sequence
>gi|3548903|gb|AF052606.1| Exophiala dermatitidis chitin synthase 2 (CHS2) gene, complete cds
TCTAGAGCTGAACTGCAGTTACAAATCATGCAGCATNCCCTAAATAGAAACCATGAGCTATGCTCCAGAG
TGCAGCGTGCTTCGGCCTTGATGCCTTGCGACATAGTAGTACAACATTGTAGATCTCGCACCAACATGAC
CTATCTGGTACCCACTGCTGTAGTTCACAGGCTGTGTTATACAGGCGCGGCAGCTGTTACTGCGGCGATG
CAGTTGGCAGGGTTTAGGGGTCCGTGGGCTCCCCTGAGTGGCGGAGGTTAGGGTAGACCCTAGCAATTGG
CCTGCACCCAAAAACTCACACAACGCGGCTTCGCTACTATAGACCATTGACCTGAATCTCCTCATTCTAA
CACTCAGCTGCCTCGACAAGGCCCCCTTTTGCTATCTCCCTTCGCTTACGAGACTGTCGCAGTAATAGTG
ACTGAGAGCTCTTGACCCTCTCTTCTTTGAATACTCGTCACTAGACCACCAGTCGCATATCCAATACCAA
CAGGGCGCAAACTGCGTCGCCCTGGTCGGTCAGCGAGTAAACAACTTTCTCCACTCTTTCCTGATCATTG
TCTGCATCAACACCAAGGCTGTTCTGGTCAACAAAGTTGCCTTTTGCGCAACATATTTTCGGACCCAGGC
CCTGACGCCAGGGTACCCGGTCCTCAAACACTTGTTCCCTGGTTCTACATTCCGAAGTGCTGAACACAGA
CCAGACCACTCCTTTCTGACCACCTTTGGTCGCTCCCTCAATCTGGGCCGACATGGCCTACAACCGTCTA
GGTAAACACCACTTCCATACTGCGGCCTGTGGCAATTTGTATGCTGATTACTGTGCATAGGCAGTCCCCA
GCGGGATGGTCCTTATTCTCCCAGCGCTCAACCTCAATACGACTCGAGATCGCCCTCGCCAGGTCGACCC
TTACAGCCCTATATCCATCCTGACGAAGCCTACGCGCGACAGCAGCCTCTGCATTTGCAAATGCCCACCG
CCTCTGATGACCGACTAGCCATGCAGCCTACGTATTCGGTCGAGAATGTTCACAACCCCCAAGCCTACGG
TCAGCAGTATGGGCAGCATCTCCCCGACTCTGGGGACATGGGTTACGGCAGAAACGATTACATAGTTTCT
CCCGAAGAGCATCATGATGCCTATTACACACAACCATATTCCCCTCATCCACAAGGCGACTATGCCTTAG
ATCCTTATCCTTCCCACGATGAACCCTACAGACCAGATACCGACAATGTGCCAATACTCCAGCCAGATTC
GGCTTACGGCCCAGATCCGCACACGCAGCCGGGAATGGACTACGACGACTACCAGGAAGAACCTCGCCCT
ACGCCGTCGCCAGCCCCGATTAGGCGCTGGAAAACAGTCAAGGAGGTGCAGTTGTTCAATGGAAATCTAG
TGCTGGATTGCCCTGTGCCACCAAAGCTTTTAGCCAACGTTCCTCACGCGAAACCTCCTGAAAGAGACGA
ATTCACGCACATGAGATACTCGGCGGCTACATGTGATCCGTCCGACTTCCACAATGAAAGATTCACGTTG
CGGCAACGGCTCTTTGCGAAACCTAGACAGACGGAGTTGTTCATTGTGGTTACGATGTATAACGAAGACG
AGTTTCTGTTTGCACGCACGATGATTGGTGTATTCAAAAACATCGAGTTCATGTGTAACCGCAGTTCCAG
CAAGACTTGGGGAAAGGAAGCATGGAAGAAGATCGTCGTCTGTATCGTCAGCGACGGACGTGCTAAGATC
AATCCAAGAACCAGGGCTGTTCTTGCCGGTCTCGGTGTTTACCAAGATGGCATTGCCAAACAACAAGTCA
ACGGTAAAGACGTTACTGCTCACATCTACGAATATACCACGCAAGTCGGCTTGGAACTCAAAGGCACGCA
GGTTTCCCTCAAGCCTCGATCGGCTACGCCTGTGCAACTGCTATTCTGTTTGAAGGAGAAGAACCAGAAG
AAAATCAACTCGCATCGTTGGTTTTTCCAAGCCTTTGGTCGAGTCCTGGATCCGAATATTTGCGTATTGA
TTGACGCGGGAACAAAACCGGGAAAAGACTCCATCTACCAGCTGTGGAAGGCTTTTGATTTGGAGCCCAT
GTGTGGCGGTGCCTGTGGTGAAATCAAGGTCATGTTGGACCATGGCAAAAAACTCCTCAATCCTCTTGTC
GCCACGCAGAACTTCGAGTACAAGATGTCCAATATCCTGGACAAGCCGCTCGAGTCCGCTTTTGGCTTCA
TTTCCGTTTTACCGGGTGCCTTTTGCGCTTATCGCTATGTTGCCTTGCAGAATGACAAGAACGGCGTGGG
TCCCCTGGAAAAATACTTCAAGGGAGAAACGATGCACGCTGATGCAGGAGTCTTCACTGCCAACATGTAT
CTTGCCGAAGATCGCATTCTCTGTTTCGAGCTAGTCAGCAAACGCAACTGTCGGTGGATTCTGCAGTACG
TCAAATCCGCCACGGGTGAGACCGATGTCCCGGACCGAATTCCAGAGTTTGTGCTGCAACGACGACGATG
GTTGAATGGCTCATTTTTTGCCGCCGTGTACGCAGTTGCACACGTATACCAGCTTTGGCGAACGGACCAC
AGTTTCCTCCGCAAACTCATGTTTCTGATCGAATTCACCTATCAGACGATCAACATGCTTTTTGCCTGGT
TCGCAATTGGCAACTTTTTTCTGGTGTTCAGGCTCTTGACGGCCTCGTTAGGCACAAAGGAGACACTGGG
AACGGCAGGCACAGTACTAGGAGTGGTCTTTGAATTTGTGTATCTCGGAACACTCCTTTACTGCTTCATC
TTATCCATGGGTAACAGGCCACAAGGAAACCCGAAGTCATACATGATGATGGTGATTTTCTGGTCGGTGC
TCATGGTTTGGTTGACGTTCGCCTCCATTTTCTTGACGGTTAAATCGATCGAGACCGAAGTCCAACAAAA
GGACTTTAGCTTCTCCACGATCTTCAACAACAGCACATTTTTCGGTCTTATTGTGTCCCTTGCCAGTACT
TACGTACTTTGGTTCGTGGCGAGCTTCTTGTTCTTCGATCCTTGGCATATGTTCACTTGCTTCCTCCAGT
ATATTGTCCTCACACCAACCTACATCAACGTTCTGAACATCTACGCCTTTTGCAACACTCACGACATCAC
ATGGGGTACGAAAGGTGACGACAAAGCCGAGAAGCTTCCCAGCGCAAATGTCAAACCCGGTGGCAAGGTG
GACGTGTTAATTCCACAGGACGATGGAGATTTGAACGCTCAGTACGATTCCGAATTGAAGAAGTTCGCCA
CCAAGCCACCCAAAGAAGTCAAAGCACCCAATCCAGCCGATAAACAGGAGGATTACTACAAATCTTTCCG
AAGCAATGTCGTCACAGCGTGGATGATCACCAACTTCATCTTGGTTGCCGCGGTTTTGAACATTGCAGGG
TTTGACCGGATAAACGTCCATGATACCCAGCAGCAGAATTCGACAATCTACCTGGCCGTTATTCTGTGGT
CGGTAGCCGGATTGTCTCTTTTCAGATTCACTGGGGCCTGTTGGTTTTTGGTTGTGAGGATGGTGAGTTT
GGAAATATGGTCCGTTTGCAAGGTTTGACGCTAACTGAGTCCAGTTCCGTGGTGTTTGAAATCTGATACC
CGAAGACGGTCATGAGCGATGCGACATATTGGTTTGGTTTTCTTGCGGTCTATCTCCTAGTATGACTCTT
CTGGATACGTCTGGTGATAAAGGCTTTCTACGACGCGATACCCCAGGAAATTGTGATGAGTGACGGGTTC
TGAGTTGGCTGCTTCACACGGCGGAAGCACATGGAGTGCATGGATTCAATTGTATANGTAACGGCTGTGT
AAAACGTCAAGTTGTTGAGTAAGAAAAATGAACCGCAGTCCGAANGGCCAGCTGGACGTCATGCTCAGCC
TCGTCCTTGAATGTATGAAGCAGCTCCTTTTAGTGAGCCTCCCGCGCCTGACTCGGCCAGAATCTTATTT
TGGAGATGACATTGCCCTATATGATATTANGATTGGGTANATGAACAAAAATCGTTGAAGCAAAAATTTC
AATGCCGATCATTTCTGTACAACCGATGCCGANCGCTGTGGCCGAACCCANANTGATAGTATGGATAACC
GGGCCGCAGGATCATGGTTTCGTTATGACTCTACATTATTTTTATGAACAAGCCACCTCACTTTGAACTC
TCCGGCGTTGAATCTCTCCGTGTCCCTCCATACCANTATGGCCANGGTNCGGATTTACTGA

Molecule Role Virulence factor
Molecule Role Annotation MUTATION: wdchs3/wdchs2 double mutant is attenuated in mice (Wang et al., 2001).
References
Wang et al., 2001: Wang Z, Zheng L, Liu H, Wang Q, Hauser M, Kauffman S, Becker JM, Szaniszlo PJ. WdChs2p, a class I chitin synthase, together with WdChs3p (class III) contributes to virulence in Wangiella (Exophiala) dermatitidis. Infection and immunity. 2001; 69(12); 7517-7526. [PubMed: 11705928].