Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

CHS3

Victor ID 4825
Gene Name CHS3
Sequence Strain (Species/Organism) Exophiala dermatitidis 8656
NCBI Nucleotide GI 3582754
NCBI Protein GI 3582755
Protein Accession AAC35278.1
Taxonomy ID 5970
Gene Strand (Orientation) ?
Protein Name chitin synthase 3
Protein Note Chs3p
DNA Sequence
>gi|3582754|gb|AF053314.1| Exophiala dermatitidis chitin synthase 3 (CHS3) gene, complete cds
GATCTGGTCCTGCAATAATGATCATTGAGCGTGTCTCGGAAGGATTGCTACCAGTGTCCAGCGGTCGTCA
GCGACATCTGTCGGCGGGCCACTATTGACTGCCATGGCAGAATAGACGTTCTGACAGATCAAATCGCTCA
CCACACAGTCAAAAGTTGCAAGTTTCTCTGTTTGGATTGCTTATTAACCTCTGCGTGGTAATAGAGTATC
CTATGCTCGTTCGACACCTGTTGGTAGTATATCTTGCTCGAGATTCAAGTAAGACCCTCCCGATCTTAAG
TCAGGCCAAGCGATTATCCATCAAAGTCAGATAGTACCTTACTTTCGTGTGTTCGTTTTCTGGAATCGGT
TCTCCGTTGCATCTCCATCGTGAAGTGAAATATATCCCTTACAGTGTTAGCCGTGTCTCTCATGTGTGCA
GTGGCAGAAATTACGGCGAGCCAACAACTAGTACTGGCTATCTGGCACGTTATCTCGCCCCGTTNACAAG
CACCTGAGCCGTCGAATCGACCGTTATCCAAATTTTTGCCAGCCTCGTACTAATATAAAGGGGATCATGC
ACAGTGCATTGCACAGCCATGCTTCTAAAAACATCTACCAAGGCGTTACAACGTTGTACTGTGTGGTGTT
CACCTTTCAGTTGTCTGGGATTCAGGAACAAATACAAGTGGCGTTATAGACCTATGGACAGATGTTGTTT
CCTTGCCAGTGCTAGCCAACGAGAGGCACACCACAGAAGGACTTCCGTCAATGTACCTGGTACCTGAATA
CTACCCGACATGCCCATCCAAAGCATGCTGTCCCCACGCCACCAACAACTGCATTGCGGAGAATCAATAG
GATATCCATATACTCCTTTTCTGTGGCGCGCACCACGCAATGAGCGGGTCAGGGAGACGGTTAGACCCTG
GTAGTTGTCCCAAGGAAGCCATCCGAGTCGCACAACTGAAGGAAACAGCAGTCTTTGAGCTGGATCCTCC
AGTCCTGCTCTAGTACCCTAGGTATGTTGCGTTTGACAGTATCGTGGTACAACCCAGTCAGCTTCATGCC
TTGCCCTTCAGATACTGCACAGTGGTACCTTAGTAGGGTGGTAATAATAGTGAGGGCCACTGATTGTGGG
GGCCTGAGCCTGCCGCGAGCCGCCAGCCACAATTGAAGCTGAGCGCAGATCCGCAGCAAACCACCCAAGA
TGTCAATTCCACCCTGATCCTGCACAGCCCTGGCTCCCAAGCTTCCAAGCCTCCTAAGACTGTGTCTCGT
GACGTACGAGAACGATGAATGGTTCTCTATGCGTGTTTGGAAGCCCAGTAGTTGCAGTGGGAACGAGGCG
CCGAACCACTGACAGGGCGAAACCGCCGATTGGGCCAGTCGTCAAGCGACAGTGGCAGCGTTGTCCCAGC
TACATTTTGAATGCTCAGCTGGCAGGGCCTCAGGGGGCTGTCGCTGATGATTCGCAACTCTGCATGCATC
CATCTGGCAAGGGTTCAAAGAAAACCTGAAACGCCTGTCAGTCCTCTCGTCCTTGTCTCGCCTGGAAAGT
CTTGTCCTATGCTCACCGTGCTTCCTATGTTGTGAATTCTTTGTCCTTGTCCGCTCTACACTTCACTCCC
GCATCCGTCTCACGCCCACCTTGAACATACTTCATCACTCCCTCACTGCTGCAACCTGCGGCTGGGAGAT
ATCGCCTGAACCAAGTCGGCCCTGGTGGTCATCTTGATAAATTGTCCCTTATCATCACCATACTAGTATT
TACCCTCTGTCGCTGATCAACCGCCCATTATTCTGGCGACCCCATCGTTTGCCCGATCCTGAGCCTGTTT
CGAGGGCATACTACTCGCAGTTGCGCTCGGAGACATGGCGAGCCAATATCCCGGCCATCAGCTAGACGAC
ATTCCCTCGACAAATGTATGGCAATGCAGGTCCAACTTTTGCAGCCATTATATACTGACGTTGTGTAGGT
CTATCGGCCTCCTCCCCGTCATGAAGACGATGAAGCAGAACATGCTCTACTCCACCAAAACTCCGCATAT
CAGTCCCAATATGACGACCCTCACTCTCGACCTCTGACGCCGGGGCAAGAATCAGTCTACACCTTGAACG
AGTCCTACGTAGGAGGGGATCCTTCAAAAGTGCCCGTGACCAGTTACAATCCCCAATACACTCAACCTTA
TGGCCAAGGCTATGGTATGAACAATTCGCGTCCAGGTTTTCCTACCCCGGGCCCTCCCGACCCTATTGAC
CGGACGGATTCAACCGAAGCGTGGAGGGAGAGACAAGCGCCGGGATTCGGCACTATCAAGAGATATGCTA
CGAGGAAAGTCAAACTGGTGCAGGGTAGCGTTCTGAGCATTGATTACCCTGTTCCCAGCGCCATTCAGAA
TGCCATTCAAGCAAAGTACCGCAATGACCTAGAGGGGGGCAGCGAAGAGTTCACACATATGCGGTACACC
GCGGCGACATGTGATCCTGATGATTTCACCTTGAAGAATGGGTACAATCTGCGACCAGCCATGTACAACC
GGCATACCGAGTTATTGATCGCCATTACATATTACAATGAGGATAAGGTCTTAACGGCCCGCACCCTCCA
CGGTGTCATGCAGAATATCCGGGATATCGTCAACCTGAAGAAATCCGAGTTCTGGAACAAGGGCGGTCCA
GCGTGGCAGAAGATCGTCGTCTGTCTTGTGTTTGACGGCATCGATCCCTGCGACAAGAATACTCTCGACG
TTTTAGCCACGATCGGAGTCTACCAAGACGGGGTCATGAAGAAGGATGTCGACGGCAAGGAAACTGTGGC
TCATATCTTTGAATACACAACCCAGCTTTCCGTTACTGCCAATCAGCAACTCATTCGGCCCAATGACAAC
GACGCGACTTCCCTACCACCAGCACAGATGATATTTTGCCTGAAGCAAAAGAACAGAAAAAAGATCAATT
CTCATCGATGGTTATTCAATGCTTTCGGCCGCATCTTGAATCCCGAAGTCTGTATCTTGCTCGATGCAGG
AACCAAACCGGGCTCGAAGTCGCTGATGGCACTGTGGCAGGCGTTTTACAATGACAAAGACTTGGGCGGT
GCTTGTGGTGAAATCCATGCCATGTTGGGACCCGGCGGCGTTTTTGGAAGGAAGCTTTTGAACCCCTTGG
TGGCAGCACAAAATTTCGAGTACAAGATCAGCAACATCCTCGACAAGCCCCTGGAAAGCTCGTTCGGTTA
TGTCAGTGTCTTGCCCGGTGCATTCTCTGCCTATCGCTTCAGAGCTATCATGGGTCGCCCTCTTGAACAA
TATTTCCACGGTGATCACACTCTTTCCAAGACACTAGGCAAGAAGGGGATCGAAGGCATGAACATTTTCA
AGAAGAACATGTTTTTGGCCGAAGATCGTATTTTGTGCTTTGAGCTGGTCGCCAAAGCCGGGTCGAAATG
GCATCTGTCCTACGTCAAAGCCTCCAAAGCTGAAACAGATGTGCCAGAAGGCCCTCCCGAGTTCATCGGC
CAGCGTCGACGTTGGTTGAACGGCTCCTTTGCTGCATCCATGTACTGTTTGATGCATTTCTCGCGCATGT
ACAAGTCTGGTCATAACTTGATTCGGATGTTTTTCCTCCACATCCAGATGATCTACAACATTGTTTCGGT
TTTGCTGTCCTGGTTCTCCCTCGCCTCCTTCTGGCTGACGACCAAGGTTTTGATGGATCTCGTGGGTCAA
CCCAGTACCAGCAATGATAACGCGGCCTTCCCGTTCGGCAACACAGCGACGCCAATCATCAACACAATTC
TTCAATACTTGTACCTGGCGTTTCTGCTCTTGCAATTCATCCTGGCCCTGGGAAATCGACCCAAGGGTTC
GAAAGTCGCTTACATCATCTCATTCTGTCTCTTCGGCCTCATTCAGCTCTACGTCATCGTATTGTCGATG
TATCTGGTGGTACGAGCCTTCACCACCAAGAATGGGACTGACATCGTTACGAACGAAGGGGCGAATGAGT
TTGTCAAGTCCTTCTTCGCGTCGACCGGCCCCGGAATTGTCATCATTGCCCTTGCCGCAACATTTGGACT
GTACTTTGTTGCCTCCTTCCTATACATGGATCCGTGGCATATGTTTACGTCCTTCGCCCAGTACCTGCTC
CTCATGCCATCATTCATCAACATCCTGATGATCTACGCTTTTAGTAATTGGCATGATGTGTCTTGGGGAA
CCAAGGGCTCAGACAAGGCCGATGTTCTGCCTTCGGCACAGACCAAGAAGGACGAAAAGAGCAAGACTGC
AGTCGTCGAAGAAGTTGATAAACCTCAAGCAGACATTGACAGTCAGTTTGAGGCGACTGTTCGGCGTGCT
TTAGCTCCTTACAAACCACCTGAGGAAAAGGAAGAGAAGACTTTGGAAGACTCGTACAAGAACTTCCGAA
CTCGACTGGTGGCCACTTGGATCTTTTCGAATGCTCTTCTGGCTGTTGCCATCACCAGTGACAGTCTTGA
TCGATTTGGATTTACGGTAAGATAATGACTGTTCCCATTTCCACGCGTCCTAACATTCTTATAGTCCGAG
CCACTTCGCGGACCAGCCATTTCTTCCAGGCGCTTCTGTGGACTACTGCGACCTTGTCTTTGATTCGTTT
CCTGGGATGCTGTTGGTTTCTCGGAAGAACTGGGTTGTTGTGCTGCTTCAACAGACGATAAGTCGAGTGT
TTCGATTTTGCATTGCAACGTGTTCTCAAGAGCATATCGGACGTAGAGAATCGTGGCCTGAAGCTGCTTA
CGGATGTCGAAAAATAAAAGCATCGTGTGTCTGAGCATATGGAAACGGATCAGCTGCGATGTTACAGAAT
CTCCTTGTAGACGTAGTGCTCCGAGTCCGAGTCGTAATGGACGTTTTAACATTCCCCAAAATCGTGGTTG
GCCACATCGGGAGATCCACTACAACTAGAGCGGCCGCACC

Molecule Role Virulence factor
Molecule Role Annotation MUTATION: wdchs3/wdchs2 double mutant is attenuated in mice (Wang et al., 2001).
References
Wang et al., 2001: Wang Z, Zheng L, Liu H, Wang Q, Hauser M, Kauffman S, Becker JM, Szaniszlo PJ. WdChs2p, a class I chitin synthase, together with WdChs3p (class III) contributes to virulence in Wangiella (Exophiala) dermatitidis. Infection and immunity. 2001; 69(12); 7517-7526. [PubMed: 11705928].