Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

CHS5

Victor ID 4826
Gene Name CHS5
Sequence Strain (Species/Organism) Exophiala dermatitidis
NCBI Nucleotide GI 61740415
NCBI Protein GI 61740416
Protein Accession AAL79830.2
Taxonomy ID 5970
Gene Strand (Orientation) ?
Protein Name chitin synthase V
Protein Note WdCHS5
DNA Sequence
>gi|61740415|gb|AF469116.2| Exophiala dermatitidis chitin synthase V (CHS5) gene, complete cds
ATCAGAAGGAGCGGTAGGGTCTTTTCCTGTACTTTGGACGGTTTTCGGAAGTTCATGGCCATGACGCCTT
TGAGAATGTTTTCCTCCCTGGATTTGTCAGTCGTCAAGGCCTCCGTTCTCCTCGGGGCTTTATCACTTAC
AAGCCTAATTGCTCGAAAGAAGTAGCCGAGTACAAGGGATTGTTCGGGTCTGCTTGCATGTCCGCCAACT
TGACCTCGACTTCAAACTCCGGCTCTTGCAACTCCGATCCACCAAAAGGTGCGGTGGCGCCATCGACCTG
AGAGACCGACTCGGACGCAGGGGCCTCTGGCTTTGACTCTTTGGGCTTCTTCTCGTCCACCTTTGTAACC
GCAGAGGGGTTTTCTGTCGCCGGCGAAGCGACCTCATCTGCCCACGATGTGCCAGAGGTAGGTTGGAATG
ACTCGGCCTGCGCGTTCATTGTGTCCGGTTTGGAGATACGGTCGGCCAAGGAGCCGCCTCCAGAAGTAGG
AGCGGACATTGTCCCTGCGACGCTGGGGGTGGATTGCGCGCAAAGCGGGATCAACAAGGGAGGATCGAAA
GACTTGGTCGGGGATCTATAAGTTAGTGTACCTATTCTAGAGGGTCTATAGAGTATTTTAATAAGTTTTC
ATAGAAGTTGAGCTTCTGGTATAGAAGTAATCACGGTTCTTGTAGGGACGGTTTTTAGGGAATAAACCGC
CATTATTTTTGACACCAAGCCCTAGGCCGACTGGGAGGGGCCCAGCGTCTGGGGAGCAAACACCAGGGCA
GTCCCCGGCACGCAGCGGTACCGGTAACAGCGTTACAATACGAGTGCTGCAAGCTCACGCTCTTCGTCCA
TACGTGCAGCGCCCACCAAACACCTAAGGAGCCTCGCCCCTGCACCAAAACACTCCTTGAATATTGTCCC
AAAGATCAGACTCCTGGCACATCATTTCGCTCGCTCGCTCGCTCGATATTGTTGTTGTTGCTTTCACATT
GCTGCAACTCCTTGATTACGACTTGACGATTCTTCGTTCGCTTCTTTCGCTTTGTATGATTTAATCCAGC
GCCTTTGCATTGCATTGGTCTCCTCGCCGTTCGCTCTGCAGCCTGCGGCGTTGTCCTCGACACTCGTTGA
CTTCAATTCAGCACTACTTCATCTTAACCGAACTCGTCGATGAGGGAGAGGGCCGCCAGGTTGTAGAGGC
ATCGGAGCCCGGCAAGATCTCTGGTTGCAACACCATTGACGCGCCTGGGCCATTGAAGTTCACCATGGCC
ACTCGAGGGAACGTCCCTGCACATATGCAGGCGTCCTTGCCTGCTCTTCCGGCTCATTTGCAATCAGATA
CCCACATAACCGCCCATCTTGCGAGCCGATTCCATGTTTCTTTGCCGACAGCGAGGTTATCGTCGCAGGG
ACTCATATGCCTCAACACCTTCACCTCTTCGACGCGAGGACCGAATGGAGACAAGGAAGGGAGTGCCATG
GGGGAGCCGGAGGACCTGGCACGCCGGGCCTGGGCCAGGCTGGGTAATAGAGCGGAAGACCAAGCATTTG
GTTTCTTGTAAAGTGCTGCTGAAAGTGCGGATTAAATGGTCAACACTGACTGTGCTACAGCGGGGAGTCT
GGGTCGGGGAAGACGACAGTCAGGTCGCACCTCCTTTCCTCGTTCCTCTCGTTTTCGTCCACACCTCTAT
CATCAAAACTATCCCTCGCTGCCTTCGTCTTTGACACCCTGACCACTACCAAGACAACTACGACCCAAAC
TGCCTCCAAAGCAGGTTTATTTTACGAGCTACAGTACGATGCTTCGTCGAATAACCCTACCCTTATCGGA
GGCAAGTTGTTGGACCATCGCTTTGAAAGAAGCCGTATTTCACATGTCCCAACGGGTGAACGGAGCTTTC
ATGTATTATACTACCTTCTCGCCGGTACAAGCGCCGCCGAGAAGTCCCATCTCGGCCTGGATGGCCATGT
CAACATCACAACCGCCGGAACCGGCCTAAGCAGGTCCGCTTCTGTATCGCACAAGAGATGGAGATATTTG
GGCCACCCCACGCAAATGAAAGTTGGCATCAATGACGCAGAAGGCTTCCAGCATTTCAAAAACGCGCTGC
GGAAATTGGAGTTCCCCAGGACCGAAATCGCCGAAATCTGCCAGGTACTGGCAGCAATTCTTCATATCGG
CCAATTGGAGTTCGGTACAGGACAGGCAACTCTTACAGCAGCCGAGGAAAGCGGCGGTTATTCTCATGAG
GGCGGTGAGACCGTCACCGTGGTCAAGAATAGGGACACACTTGCTATAGTGGCTGCTTTCTTGGGGCTTG
GTGTTCAGGACCTGGAGGAGAGCCTGAGGTACAAGACGAGGACCATCCACCGCGAGCGTGTCACCGTTAT
GCTCGACACGAAAGGCGCTCGCGAAAACGCTGATGAGCTCGCCACGACTCTGTATTCGCTCTTGGTTACC
TACATTATCGAGAGTATCAACCAGAGGGTTTGCGCGGCCGAGGACTCGGTGGCTAACACTATCTCCATTG
TGGACTTTCCTGGCTTTGCTGACCACTCGTCCACCGGCTCTGTCCTAGACCAACTGCTGAACAATGCAGC
CAATGAGTCGCTCTACAACACGTGCTTGCACAGCATTTTCGAGAAGACTGCTGAGATGCTGGAGAGCGAA
GAGGTCAGTGTTCCGGCAACAAGCTATTTTGATAACTCAGATGCTGTCCGTGGCCTTTTGAAGCACGGTA
ACGGATTACTGGCTATTCTCGACGATCAAACACGGCGCGGTCGCACAGATGTACAGTTCCTGGAAAGCTT
GCGGAAGAGATTCGAAAACAAGAACAAGGCCATCACCGTGGGCAGCGCCACATCAACAATGCCGGGTAGC
AATTTCGCAACCACCAACCTTGCCGCTTCATTCACCGTGCGCCACTATGCTGGAGAAGTCGATTACCCAG
TGCATAGTCTGGTGGAAGAGAATGGGGACGTTGTTTCTGGCGACTTGATGAATATGATCAAAGCCACCAA
AAGCGATTTCGTCGCGAACTTGTTTGGTCAAGAAGCCTTGAACACCGTCAGCCACCCAGCCGAAAAGACA
GCCATCGTCCAGGCCCAGGTCAGCTCGAAACCACTGCGGATGCCCAGCGTCTCGAGGAAGAAGCATGATC
AGTTGCGCAGAATGGCAAGCCGAAGGGCAGATCGTTCTCCAGCCCCTCAGGAAGAAGAACCCCTGCCAGG
TACAGAAGAAGCGAAGGTCAGGCGGACAAAGCCCACTGCGACCGGATTGACTCAGGGTGCTGCAGCACAG
TTCTTATCGGCTCTGGACAACATTACCAAATCGCTGACCGCACCAAATGTGAACAATTACTTTGTCTTTT
GTCTCAAGCCCAACGACAGACGGATAGCCAACCAGTTCGACAGCAAATGTGTACGTCAACAAGTTCAGAT
GTTCGGCATTGCCGAAATCAGCCAAAGACTACGCACTGCGGATTTTACTATTTTCCTGCCTTTTGGAGAA
TTTCTCGGGCTGACAAACGCTGACGGCGGTGTCGTCGGGAGCGATCGTGAAAAGGCGCAGCTTGTTCTCG
ACAGTAAACACTGGCCCCCAAACGAGGCACGCATCGGAAATACTGGTGTCTTCCTGAGTGAACGTTGCTG
GGCCAGCATTGCGCTTACAGGGTCTCAAGCAGCAGCTTACTTCGGAGGCGATATCGGCTCGCCGTCTAGA
CCTGATACCCCGGGTCATAATCCGTTCAGTGATTCCAAGGCCCGACTAGTTGGTTCAGCTGATGGAACTC
CCGGGTCGTTTTATGGCGATGAAGCCAAGGGCGGTGGCTATTTTGGCAGTCGAGAACTTGACGCCAAGTC
AGACGCTGGAGCATCCGCTTTTCATTCAGGGGATATGTTCCGCAACCTCGAAACCAAGGAGGAACTCGCC
GAGAAGGGCAACAAGAAGAAGGTTGAAGAAGTCGATGTTGTTCCGGTTTCGTCTAGCCGGAAGCGATGGC
TTGCTATCGTCTACTTCTTGACCTGGTACTTGCCGGACTTCGCCATCAAATGGATTGGTGGTATGAAACG
AAAGGATGTCCGAACAGCGTGGAGAGAAAAGTTCGCCATCAATCTCCTGATCTGGCTCAGCTGTGGCTTG
GTGGTCTTCTTCATCATCGTGTTCCCTGAGTTGATTTGTCCCAAACAGAATGTATACTCGGCCGCTGAGC
TGTCAGCCCATGATGGAAAAGGCAAACACAGCGCCTATGTGGCTATTCGAGGACAGGTCTTCGACTTGGG
GGCTTTCATGCCGAATCATTATCCAAAAATCATCCCGCAGAGCTCGCTCAAGAAGTACGCGGGCGTCGAT
GCCACCGGGTTGTTCCCAGTTCAAGTCTCGGCCCTCTGCCAAGGTAAAGACGGACGGGTTGATCCTACGG
TCCAGCTTGACTATACTGCAACCAACATCAGTGGCACTGCGGCCGTCATCAGCTCAACAGACGCCAACCG
GAAATACCATGATTTCCGCTACTTCACCAATGATTCCCGACCAGATTGGTTCTACGAGCAAATGATCATG
CTCAAGGCCAATTATCGCAAGGGCAGCATCGGTTATACCCCTCAGTATGTGAAGACGCTGGCTAAAAAGT
CGAAGTCGATAGCCATTCTGAATGATAGGGTCTACGACTTCACCACTTACAATGAAGGTGGGCGGAGTGT
ACGGGCTCCTCCTGGTGAAGAAGTGCCATCAGGGGTCGATACTGATTTTATGGACTCTTTGGTGGTCGAC
CTCTTTACCCAGCGAGCAGGCCACGACGTCACCAAGTATTGGAATGCGCTACCCCTTGACCCGGGCTTGA
GGAGTCGAATGCAGCTTTGTCTCGACAACTTGTTCTTCGTGGGTGTAACGGATACTCGGAATTCACCACG
GTGTCTTTTCGCCCGATACATTCTGCTCGCAGTATCGATTCTGCTGTGCAGTGTCATTGGCTTCAAATTC
TTTGCCGCGCTTCAATTTGGAGGCAAAAATGTGCCTGAGAACCTGGACAAGTTTGTCATCTGCCAGGTGC
CTGCCTACACAGAAGATGAGGACTCACTTCGCCGTGCCATTGACTCTGCGGCTCGCATGCGATACGATGA
CAAACGCAAATTGCTCATTGTGGTGTGCGATGGTATGATTATTGGCCAGGGCAATGACCGACCGACCCCT
CGTATCGTGTTGGATATTCTGGGCGTTTCTGAAACCGTCGATCCAGAACCGCTCAGCTTCGAATCGCTTG
GTGAAGGTATGAAACAGCACAACATGGGCAAGGTCTATTCGGGTCTCTATGAAGTGCAGGGGCATATTGT
CCCTTTCATGGTGGTTGTCAAGGTCGGTAAACCATCCGAAGTATCTCGGCCGGGCAACCGAGGCAAGCGG
GATTCTCAGATGGTCATCATGCGCTTCCTCCACAGAGTTCACTATAACCTGCCAATGAGTCCCTTGGAAC
TTGAGATGCACCACCAGATTCGCAACATCATCGGGGTCAATCCGACTTTCTACGAGTTTATGCTTCAAAT
CGATGCCGACACGGTCGTCGCCCCGGATTCGGCCACGCGCATGGTTTCGGCATTCTTGCGTGATACCCGC
CTGATTGGTGTTTGTGGCGAAACGTCACTGTCCAATGCCAAGTCGTCCTTCATCACGATGATGCAGGTTT
ACGAGTACTACATTTCGCACAACCTCACCAAGGCGTTTGAGTCGTTGTTCGGCTCGGTGACATGTGTGCC
AGGTTGTTTCACCATGTATCGCATTCGGGCGGCCGAGACAGGCAAGCCGCTGTTCGTCAGCAAGGAGATC
ATCCAAGACTATTCGGAAATCCGAGTTGACACCCTGCACATGAAGAATCTGCTCCATCTCGGTGAAGACA
GGTATCTGACCACGCTGCTATTGAAGTACCATTCCAAGTACAAGACCAAGTACATTTTCCACGCTCACGC
ATGGACCATTGCTCCCGACAGCTGGAAGGTCTTCATGTCGCAACGGCGGCGATGGATCAACAGTACGGTA
CACAACCTGATTGAACTGATCCCGCTACAACAGCTATGTGGGTTCTGCTGTTTCAGCATGCGGTTCGTCG
TGTTCCTAGATTTGTTGTCTACGGTTGTGGCGCCAGTCACAGTCGCATACATTGCATATTTGATTGTGCT
CCTCGCAACAGAATCCGATGTGGTACCATTGACCGCATTCATCCTTCTGGGCGCAATCTATGGTCTACAA
GCCATCATCTTCATTCTTCGTCGGAAATGGGAAATGATTGGCTGGATGATTGTCTACATCCTGGCGATGC
CGGTGTTCTCCCTGGGACTTCCTTTGTACGCCTTCTGGCATATGGATGACTTCAGTTGGGGCAACACCCG
TCTGGTCAGGGGCGAACATGGGAAGCAGATCTTGCTGTCAGATGAAGGCAAGTTCGGCCCTGACTCCATT
CCCAAGAAGAAATGGGAGGAGTATCAAGCGGAACTTTGGGACGCGCAAACTCAACGAGACGATGCCCGCT
CCGAACTGTCAGGTTACAGTTATGGCACAAAGTCTTATCTTCCCACTGGCTCTGTCTATGGTGGAGGGTA
CAATGACACACAGCACCTGATGATGGCGCCCTCGCGGTCCGCATCGCAGCTCGACATGCACCCTACGCCA
ATGTACGGCGGTGGAGGCGGGCACAATCAATCCCGGATGTCACTGGCCCCATCGGAGATGCTGGGCAGCC
AGAGTAACCTGATGATGCCAAGCGGAAGGTCCGTCGCGGATATGGAGATGTCCGACCTGACCGGATTACC
TACGGACGACATGCTCCTCAACGAGATCCGAGACATTTTGAGGACGGCCGACCTAATGACAGTCACGAAG
AAAGGTATCAAGCAAGAATTGGAACGGCGGTTCAATGTCAACCTGGATATGAAGCGGGCGTATATTGGAA
GTGGTATGTTTGAATCCCCGATCCTGTACCCTTTTACTCTACTGACTCTTTTCACTACAGCCACCGAAGC
CATTTTGTCTGGGCAACTGTGACGGATCTGTTTGATTAGAATGCTCGCCATGTTCTATTTAGCAAGTCAT
GATCTTGTATATACTGCTTAATATAGGACGGAGTCTGTGGGGTTGACCAAAAGACGGCTCAGTATGTGGG
CGGCATGCAGGTGGTAAATTTTCTATCTATACATATCATGAAAGTGTCTGCCATGGTCGATGGCAACATT
TCAGCTGCGATGAAGATGAACATTGTTTTCAACCGCGCGGATGCGAGACCCAGTACCCTGTATCGCTATG
GGCGGTCATGCCGTTTACAAGTTTGTTCATGAGGGTAGAACTGCTCCGACAGGTTTCTCATCGTA

Molecule Role Virulence factor
Molecule Role Annotation MUTATION: wdchs5 mutant is less virulent in mice than parental strain (Liu et al., 2004).
References
Liu et al., 2004: Liu H, Kauffman S, Becker JM, Szaniszlo PJ. Wangiella (Exophiala) dermatitidis WdChs5p, a class V chitin synthase, is essential for sustained cell growth at temperature of infection. Eukaryotic cell. 2004; 3(1); 40-51. [PubMed: 14871935].